Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr2A

Orthogroup ID

OG0002752

Physical Location & Seq

Genomic Coordinates Forward (+)

19717604 .. 19719350

Gene Structure 1747 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh2AG196400.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 300 bp

ATGGATGTTGATACCGCAACTTCTGCTACTCAAGTTCCCAAGAAACATGCCTCGCCTGAGCTAGATATTTACTGCTACTTGCTGGTGCTGATTTTTCTGATTGATAAGAAAGAATACAATGAGGCTAAAGCTTGTGCCACAGCTGGCATTGCTCGACTAAAGAACATGAATAGGAGAACTGTTGATGTCCTGGCATCAAGGCTTTACTTCTATCACTCTCTTAGCTATGAATATACAGGGAGTAGTTTAAGTCAGTCATCTTTCGTCCAGATAAGTGGAGGGGAGTTCCTACTAAATTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044464

KEGG Pathways

Metabolic & Signaling

ko03050 ko05169 map03050 map05169

Pfam Domains

Protein Families

PCI Rpn3_C

Protein Analysis

99

Amino Acids

11.09

Weight (kDa)

6.71

Isoelectric Point (pI)

34.38

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
TPR_PSMD3_N	PF25573	8 - 81	1.6e-24	PSMD3-like, N-terminal TPR repeats

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002752)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G20200 AT1G75990
fragaria_vesca	FvH4_2g15510 FvH4_2g15510
malus_domestica	MD05G1123400.v1.1 MD08G1008900.v1.1 MD10G1126400.v1.1
prunus_persica	Prupe.1G360600_v2.0.a1 Prupe.1G360600_v2.0.a1 Prupe.8G167300_v2.0.a1
pyrus_communis	pycom05g11770 pycom06g20010 pycom10g10860
rosa_chinensis	RchiOBHm_Chr6g0278511
rosa_laevigata	RLG00000007962 RLG00000013222
rosa_multiflora	Rmu_sc0000258.1_g000009 Rmu_sc0002777.1_g000004
rosa_roxburghii	Rroxscaffold_1G00029920 Rroxscaffold_4G00323800 Rroxscaffold_7G00189830 Rroxscaffold_7G00190320
rosa_rugosa	Rorug06G0117600
rosa_samantha	Rh2AG183600 Rh2AG196400 Rh2BG209000 Rh2DG190000 Rh2DG204200 Rh4AG134600 Rh4AG183800 Rh4DG179200 Rh5AG337600 Rh6AG226700 Rh6BG230900 Rh6CG234000 Rh6DG225300
rosa_wichuraiana	Rw0G003080 Rw4G016480 Rw6G019790

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	15
AjnI	CCWGG	1 cut(s)	189
AluBI	AGCT	4 cut(s)	61, 131, 143, 225
AluI	AGCT	4 cut(s)	61, 131, 143, 225
BciT130I	CCWGG	1 cut(s)	191
BfaI	CTAG	1 cut(s)	62
Bme1390I	CCNGG	1 cut(s)	191
BmrFI	CCNGG	1 cut(s)	191
BmsI	GCATC	1 cut(s)	203
Bpu10I	CCTNAGC	1 cut(s)	57
BpuEI	CTTGAG	1 cut(s)	15
Bse3DI	GCAATG	1 cut(s)	147
BseBI	CCWGG	1 cut(s)	191
BseGI	GGATG	1 cut(s)	10
BseMI	GCAATG	1 cut(s)	147
BseMII	CTCAG	1 cut(s)	48
BspACI	CCGC	1 cut(s)	15
BspCNI	CTCAG	1 cut(s)	49
BsrDI	GCAATG	1 cut(s)	147
Bst2UI	CCWGG	1 cut(s)	191
Bst4CI	ACNGT	1 cut(s)	181
BstAPI	GCANNNNNTGC	1 cut(s)	23
BstC8I	GCNNGC	1 cut(s)	145
BstDEI	CTNAG	2 cut(s)	57, 221
BstF5I	GGATG	1 cut(s)	10
BstMWI	GCNNNNNNNGC	2 cut(s)	23, 149
BstNI	CCWGG	1 cut(s)	191
BstNSI	RCATGY	1 cut(s)	50
BstSCI	CCNGG	1 cut(s)	189
BstXI	CCANNNNNNTGG	1 cut(s)	275
BtsCI	GGATG	1 cut(s)	10
Cac8I	GCNNGC	1 cut(s)	145
CviAII	CATG	2 cut(s)	47, 166
CviJI	RGCY	6 cut(s)	61, 125, 131, 143, 202, 225
CviKI_1	RGCY	6 cut(s)	61, 125, 131, 143, 202, 225
DdeI	CTNAG	2 cut(s)	57, 221
EcoRII	CCWGG	1 cut(s)	189
FaeI	CATG	2 cut(s)	50, 169
FaiI	YATR	4 cut(s)	48, 167, 228, 234
FatI	CATG	2 cut(s)	46, 165
FokI	GGATG	1 cut(s)	17
FspBI	CTAG	1 cut(s)	62
Hin1II	CATG	2 cut(s)	50, 169
HindIII	AAGCTT	1 cut(s)	129
Hpy188I	TCNGA	1 cut(s)	99
Hpy188III	TCNNGA	1 cut(s)	268
HpyCH4III	ACNGT	1 cut(s)	181
HpyF10VI	GCNNNNNNNGC	2 cut(s)	23, 149
HpyF3I	CTNAG	2 cut(s)	57, 221
Hsp92II	CATG	2 cut(s)	50, 169
LpnPI	CCDG	7 cut(s)	68, 69, 129, 176, 203, 222, 281
LweI	GCATC	1 cut(s)	203
MaeI	CTAG	1 cut(s)	62
MluCI	AATT	1 cut(s)	295
MnlI	CCTC	3 cut(s)	61, 115, 272
MseI	TTAA	1 cut(s)	248
MspA1I	CMGCKG	1 cut(s)	143
MspR9I	CCNGG	1 cut(s)	191
MvaI	CCWGG	1 cut(s)	191
MwoI	GCNNNNNNNGC	2 cut(s)	23, 149
NlaIII	CATG	2 cut(s)	50, 169
NspI	RCATGY	1 cut(s)	50
Psp6I	CCWGG	1 cut(s)	189
PspGI	CCWGG	1 cut(s)	189
PvuII	CAGCTG	1 cut(s)	143
SaqAI	TTAA	1 cut(s)	248
ScrFI	CCNGG	1 cut(s)	191
SetI	ASST	4 cut(s)	63, 133, 145, 227
SfaNI	GCATC	1 cut(s)	203
SmlI	CTYRAG	1 cut(s)	30
SmoI	CTYRAG	1 cut(s)	30
Sse9I	AATT	1 cut(s)	295
SsiI	CCGC	1 cut(s)	15
SspMI	CTAG	1 cut(s)	62
StyD4I	CCNGG	1 cut(s)	189
TaaI	ACNGT	1 cut(s)	181
TaqI	TCGA	1 cut(s)	154
TasI	AATT	1 cut(s)	295
Tru1I	TTAA	1 cut(s)	248
Tru9I	TTAA	1 cut(s)	248
TspDTI	ATGAA	2 cut(s)	182, 243
XceI	RCATGY	1 cut(s)	50
XspI	CTAG	1 cut(s)	62

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.