Rh4DG179200

26S proteasome non-ATPase regulatory subunit

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
Physical Location & Seq
Reverse (-)
35652459 .. 35670438
17980 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG179200.1

Sequence Viewer

Length: 183 bp
ATGGACGACGATGAGCATGACATGGATATTGATACTGCAACTTCTGCTACTCAAGTTCCCAAGAAACATGCCTCGCCTGAGCTAGAGATTTACTGCTACTTGCTGGTGCTGATTTTTCTGATTGATCAGAAAAAATACAGTGAGGCTCCAGGATGGAAAGATGTGCAGCCTCATGATCCTTAA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

60

Amino Acids

6.9

Weight (kDa)

4.39

Isoelectric Point (pI)

31.88

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TPR_PSMD3_N PF25573 7 - 49 6.9e-08 PSMD3-like, N-terminal TPR repeats
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 170
AjnI CCWGG 1 cut(s) 148
AluBI AGCT 1 cut(s) 82
AluI AGCT 1 cut(s) 82
AlwI GGATC 1 cut(s) 170
ApeKI GCWGC 1 cut(s) 166
BbvI GCAGC 1 cut(s) 178
BccI CCATC 1 cut(s) 147
BciT130I CCWGG 1 cut(s) 150
BclI TGATCA 1 cut(s) 124
BfaI CTAG 1 cut(s) 83
BisI GCNGC 1 cut(s) 167
BlsI GCNGC 1 cut(s) 168
Bme1390I CCNGG 1 cut(s) 150
BmiI GGNNCC 1 cut(s) 147
BmrFI CCNGG 1 cut(s) 150
BpmI CTGGAG 1 cut(s) 132
Bpu10I CCTNAGC 1 cut(s) 78
BpuEI CTTGAG 1 cut(s) 36
BseBI CCWGG 1 cut(s) 150
BseGI GGATG 1 cut(s) 158
BseMII CTCAG 1 cut(s) 69
BseXI GCAGC 1 cut(s) 178
Bsp143I GATC 2 cut(s) 124, 175
BspCNI CTCAG 1 cut(s) 70
BspHI TCATGA 1 cut(s) 172
BspLI GGNNCC 1 cut(s) 147
BspPI GGATC 1 cut(s) 170
BssMI GATC 2 cut(s) 124, 175
Bst2UI CCWGG 1 cut(s) 150
Bst4CI ACNGT 1 cut(s) 140
BstAPI GCANNNNNTGC 1 cut(s) 44
BstDEI CTNAG 1 cut(s) 78
BstF5I GGATG 1 cut(s) 158
BstKTI GATC 2 cut(s) 127, 178
BstMBI GATC 2 cut(s) 124, 175
BstMWI GCNNNNNNNGC 1 cut(s) 44
BstNI CCWGG 1 cut(s) 150
BstNSI RCATGY 1 cut(s) 71
BstSCI CCNGG 1 cut(s) 148
BstV1I GCAGC 1 cut(s) 178
BtsCI GGATG 1 cut(s) 158
BtsIMutI CAGTG 1 cut(s) 145
CciI TCATGA 1 cut(s) 172
CviAII CATG 4 cut(s) 17, 22, 68, 173
CviJI RGCY 3 cut(s) 82, 146, 169
CviKI_1 RGCY 3 cut(s) 82, 146, 169
DdeI CTNAG 1 cut(s) 78
DpnI GATC 2 cut(s) 126, 177
DpnII GATC 2 cut(s) 124, 175
EcoRII CCWGG 1 cut(s) 148
FaeI CATG 4 cut(s) 20, 25, 71, 176
FaiI YATR 4 cut(s) 18, 23, 69, 174
FatI CATG 4 cut(s) 16, 21, 67, 172
FbaI TGATCA 1 cut(s) 124
Fnu4HI GCNGC 1 cut(s) 167
FokI GGATG 1 cut(s) 165
Fsp4HI GCNGC 1 cut(s) 167
FspBI CTAG 1 cut(s) 83
GluI GCNGC 1 cut(s) 167
GsuI CTGGAG 1 cut(s) 132
Hin1II CATG 4 cut(s) 20, 25, 71, 176
Hpy188I TCNGA 2 cut(s) 120, 129
Hpy188III TCNNGA 1 cut(s) 173
Hpy99I CGWCG 1 cut(s) 11
HpyCH4III ACNGT 1 cut(s) 140
HpyCH4V TGCA 2 cut(s) 38, 166
HpyF10VI GCNNNNNNNGC 1 cut(s) 44
HpyF3I CTNAG 1 cut(s) 78
Hsp92II CATG 4 cut(s) 20, 25, 71, 176
Ksp22I TGATCA 1 cut(s) 124
Kzo9I GATC 2 cut(s) 124, 175
LmnI GCTCC 1 cut(s) 151
LpnPI CCDG 4 cut(s) 89, 90, 135, 162
Lsp1109I GCAGC 1 cut(s) 178
MaeI CTAG 1 cut(s) 83
MalI GATC 2 cut(s) 126, 177
MboI GATC 2 cut(s) 124, 175
MnlI CCTC 3 cut(s) 82, 136, 180
MseI TTAA 1 cut(s) 181
MspR9I CCNGG 1 cut(s) 150
MvaI CCWGG 1 cut(s) 150
MwoI GCNNNNNNNGC 1 cut(s) 44
NdeII GATC 2 cut(s) 124, 175
NlaIII CATG 4 cut(s) 20, 25, 71, 176
NlaIV GGNNCC 1 cut(s) 147
NspI RCATGY 1 cut(s) 71
PagI TCATGA 1 cut(s) 172
PfoI TCCNGGA 1 cut(s) 148
PkrI GCNGC 1 cut(s) 168
Psp6I CCWGG 1 cut(s) 148
PspGI CCWGG 1 cut(s) 148
PspN4I GGNNCC 1 cut(s) 147
SaqAI TTAA 1 cut(s) 181
SatI GCNGC 1 cut(s) 167
Sau3AI GATC 2 cut(s) 124, 175
ScrFI CCNGG 1 cut(s) 150
SetI ASST 1 cut(s) 84
SmlI CTYRAG 1 cut(s) 51
SmoI CTYRAG 1 cut(s) 51
SspMI CTAG 1 cut(s) 83
StyD4I CCNGG 1 cut(s) 148
TaaI ACNGT 1 cut(s) 140
Tru1I TTAA 1 cut(s) 181
Tru9I TTAA 1 cut(s) 181
TscAI CASTG 1 cut(s) 145
TseI GCWGC 1 cut(s) 166
TspRI CASTG 1 cut(s) 145
XceI RCATGY 1 cut(s) 71
XspI CTAG 1 cut(s) 83
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.