Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002784.1

Orthogroup ID

OG0002687

Physical Location & Seq

Genomic Coordinates Forward (+)

140912 .. 143426

Gene Structure 2515 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002784.1_g000034.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1506 bp

atggcatactataatatctaccctgttttggctctttacttgtcatgttttgcttctctttcatcagcgcaggacttgaagttgccattaaaatctgtgaatcttgggaactggcttgttgtagagggttggatgaaaccttctctctttgatgaaatacctaacaaagatcttttggatgggaccaaggtgcaattgaagtccacaaagcttcagaactatttggcagcagaaaatgggggtgattccattgttgttattaatcgcactgcagcctctgattgggaaactttcaggttgtggaggattgatgaaaattctttcaactttcgagtatcaaacaagcagtttgtgggattgtcaagtgagggaaccaacaggatagtagcaatgagagatgcacctggtgacaccgaagcatttcggattgtaaggaaagatggcgagccaaataggattcgcattcaagcatccaatggcttatttctccaggcaatatcagatacggtactgacagcagattatggaggctcgggttgggatgacagtgatccatccgtgtttattatgacaatagtaggctcactacaaggtgaataccaaatagcaaatggttatggtccggataaagcccctcaagtcctgcaggaccaccggaactcttacatcactgaagaggatttcagattcatgtcatccaacggcttgaatgctgtgaggataccagttggatggtggattgcatgtgatccaacacctccaaatccttttgttgggggatcattgcaagccttggacaatgctttcacttgggcacaaaaatatgggttgaaggtgattatagatctacatgcagttcaagcttcccaaaacggcatggaacacagtgcaacaagagatgggtatctggaatttggagattccagcatacaggacaccgtggaagttatagatttcctagcagaaagatatgctaaaaatccagctctcggagcaatcgagttaataaatgagccttgggcaccacttgtgactctagacaccctcaaaaattattacaaagctggttatgatgcaataaggaagtacacctcaagtgcttatgtgatcctatcaaaccgcttgggacctgctgatcgaaaggagctcctctcatttgcccaaggcctcagtaaggcagtcatagacgtgcattactacagcttgtattcagacatgttcaacggttttagtgtgcaacaaaacgtcgatttcatctacaaccagcgaggttctgatctcgctgctgtgaccacttctgatggacccctcacttttgttggggaatgggttgcagaatgggaaataaatggagcatctatggaagactaccacagatttgccaaagcacaactagatgtttatggccgtgctacttttggatgggcatactggtcttacaagtgtcagtacaatcactggagcctcaaatggatgatcgagaataactatataaaactcaattag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Cellulase

Protein Analysis

501

Amino Acids

56.31

Weight (kDa)

4.95

Isoelectric Point (pI)

26.01

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002687)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g21360 FvH4_1g21360 FvH4_1g21420 FvH4_5g37950
malus_domestica	MD01G1025400.v1.1 MD08G1178600.v1.1
prunus_persica	Prupe.1G512300_v2.0.a1 Prupe.6G181100_v2.0.a1
pyrus_communis	pycom01g05350 pycom08g15290 pycom08g15300
rosa_chinensis	RchiOBHm_Chr2g0115211 RchiOBHm_Chr7g0239891
rosa_laevigata	RLG00000000720 RLG00000018166
rosa_multiflora	Rmu_co8458197.1_g000001 Rmu_sc0000540.1_g000053 Rmu_sc0002784.1_g000034 Rmu_sc0005738.1_g000014 Rmu_sc0032904.1_g000001
rosa_roxburghii	Rroxscaffold_2G00130710 Rroxscaffold_2G00130730 Rroxscaffold_3G00220700
rosa_rugosa	Rorug02G0194700 Rorug02G0194800 Rorug02G0194800 Rorug02G0194900 Rorug07G0331000
rosa_samantha	Rh2AG252900 Rh2AG253000 Rh2BG262600 Rh2CG257600 Rh2DG261100 Rh2DG261200 Rh7AG484400 Rh7BG457600 Rh7CG501900 Rh7DG470100
rosa_wichuraiana	Rw2G019750 Rw7G040640

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	1138
AccB1I	GGYRCC	1 cut(s)	1021
AccIII	TCCGGA	1 cut(s)	622
AciI	CCGC	1 cut(s)	1120
AclWI	GGATC	4 cut(s)	545, 743, 787, 1102
AcoI	YGGCCR	1 cut(s)	1405
AcsI	RAATTY	2 cut(s)	316, 911
AcuI	CTGAAG	2 cut(s)	197, 693
AdeI	CACNNNGTG	1 cut(s)	407
AfaI	GTAC	3 cut(s)	510, 1088, 1451
AfiI	CCNNNNNNNGG	5 cut(s)	28, 282, 773, 989, 1174
AflIII	ACRYGT	1 cut(s)	1215
AgsI	TTSAA	8 cut(s)	79, 199, 325, 467, 709, 832, 860, 1222
AjiI	CACGTC	1 cut(s)	1189
AjnI	CCWGG	2 cut(s)	403, 489
AluBI	AGCT	6 cut(s)	211, 863, 986, 1064, 1147, 1203
AluI	AGCT	6 cut(s)	211, 863, 986, 1064, 1147, 1203
Alw21I	GWGCWC	1 cut(s)	1149
AlwI	GGATC	4 cut(s)	545, 743, 787, 1102
AlwNI	CAGNNNCTG	1 cut(s)	278
Ama87I	CYCGRG	1 cut(s)	532
Aor13HI	TCCGGA	1 cut(s)	622
AoxI	GGCC	2 cut(s)	1165, 1405
ApeKI	GCWGC	3 cut(s)	227, 272, 1283
ApoI	RAATTY	2 cut(s)	316, 911
AseI	ATTAAT	1 cut(s)	261
Asp700I	GAANNNNTTC	1 cut(s)	420
AspLEI	GCGC	1 cut(s)	70
AspS9I	GGNCC	5 cut(s)	183, 620, 649, 1127, 1304
AsuHPI	GGTGA	4 cut(s)	254, 419, 605, 847
AvaI	CYCGRG	1 cut(s)	532
AvaII	GGWCC	5 cut(s)	183, 620, 649, 1127, 1304
BaeGI	GKGCMC	2 cut(s)	817, 1024
BanI	GGYRCC	1 cut(s)	1021
BanII	GRGCYC	1 cut(s)	1149
BbsI	GAAGAC	1 cut(s)	1371
Bbv12I	GWGCWC	1 cut(s)	1149
BbvI	GCAGC	3 cut(s)	239, 284, 1270
BccI	CCATC	7 cut(s)	173, 434, 562, 726, 893, 1295, 1416
BceAI	ACGGC	3 cut(s)	718, 889, 1392
BciT130I	CCWGG	2 cut(s)	405, 491
BciVI	GTATCC	1 cut(s)	714
BfaI	CTAG	3 cut(s)	959, 1037, 1394
BfmI	CTRYAG	3 cut(s)	270, 644, 1198
BfuAI	ACCTGC	1 cut(s)	1138
BfuI	GTATCC	1 cut(s)	714
BglII	AGATCT	2 cut(s)	169, 844
BisI	GCNGC	3 cut(s)	228, 273, 1284
BlsI	GCNGC	3 cut(s)	229, 274, 1285
Bme1390I	CCNGG	2 cut(s)	405, 491
Bme18I	GGWCC	5 cut(s)	183, 620, 649, 1127, 1304
BmeT110I	CYCGRG	1 cut(s)	532
BmgBI	CACGTC	1 cut(s)	1189
BmgT120I	GGNCC	5 cut(s)	183, 620, 649, 1127, 1304
BmiI	GGNNCC	6 cut(s)	184, 373, 1023, 1128, 1306, 1463
BmrFI	CCNGG	2 cut(s)	405, 491
BmsI	GCATC	4 cut(s)	388, 479, 1063, 1364
BpiI	GAAGAC	1 cut(s)	1371
BplI	GAGNNNNNCTC	2 cut(s)	1136, 1168
BpmI	CTGGAG	2 cut(s)	473, 1480
BpuEI	CTTGAG	2 cut(s)	621, 1078
BsaBI	GATNNNNATC	1 cut(s)	903
BsaJI	CCNNGG	5 cut(s)	186, 792, 939, 1016, 1162
BsaWI	WCCGGW	2 cut(s)	622, 654
Bsc4I	CCNNNNNNNGG	5 cut(s)	28, 282, 773, 989, 1174
Bse1I	ACTGG	4 cut(s)	116, 725, 1436, 1463
Bse3DI	GCAATG	2 cut(s)	396, 782
Bse8I	GATNNNNATC	1 cut(s)	903
BseAI	TCCGGA	1 cut(s)	622
BseBI	CCWGG	2 cut(s)	405, 491
BseDI	CCNNGG	5 cut(s)	186, 792, 939, 1016, 1162
BseGI	GGATG	9 cut(s)	138, 184, 470, 547, 554, 695, 737, 1427, 1479
BseJI	GATNNNNATC	1 cut(s)	903
BseLI	CCNNNNNNNGG	5 cut(s)	28, 282, 773, 989, 1174
BseMI	GCAATG	2 cut(s)	396, 782
BseMII	CTCAG	1 cut(s)	1183
BseNI	ACTGG	4 cut(s)	116, 725, 1436, 1463
BseRI	GAGGAG	1 cut(s)	1139
BseSI	GKGCMC	2 cut(s)	817, 1024
BseXI	GCAGC	3 cut(s)	239, 284, 1270
BshFI	GGCC	2 cut(s)	1167, 1407
BshNI	GGYRCC	1 cut(s)	1021
BsiHKAI	GWGCWC	1 cut(s)	1149
BsiHKCI	CYCGRG	1 cut(s)	532
BsiSI	CCGG	2 cut(s)	623, 655
BslFI	GGGAC	2 cut(s)	196, 1140
BslI	CCNNNNNNNGG	5 cut(s)	28, 282, 773, 989, 1174
BsmFI	GGGAC	2 cut(s)	196, 1140
BsmI	GAATGC	2 cut(s)	462, 715
BsnI	GGCC	2 cut(s)	1167, 1407
BsoBI	CYCGRG	1 cut(s)	532
Bsp1286I	GDGCHC	3 cut(s)	817, 1024, 1149
Bsp13I	TCCGGA	1 cut(s)	622
Bsp143I	GATC	9 cut(s)	169, 550, 748, 779, 844, 1107, 1135, 1276, 1476
BspACI	CCGC	1 cut(s)	1120
BspANI	GGCC	2 cut(s)	1167, 1407
BspCNI	CTCAG	1 cut(s)	1182
BspEI	TCCGGA	1 cut(s)	622
BspLI	GGNNCC	6 cut(s)	184, 373, 1023, 1128, 1306, 1463
BspMAI	CTGCAG	2 cut(s)	274, 648
BspMI	ACCTGC	1 cut(s)	1138
BspPI	GGATC	4 cut(s)	545, 743, 787, 1102
BspT107I	GGYRCC	1 cut(s)	1021
BsrDI	GCAATG	2 cut(s)	396, 782
BsrI	ACTGG	4 cut(s)	116, 725, 1436, 1463
BssECI	CCNNGG	5 cut(s)	186, 792, 939, 1016, 1162
BssMI	GATC	9 cut(s)	169, 550, 748, 779, 844, 1107, 1135, 1276, 1476
BssT1I	CCWWGG	4 cut(s)	186, 792, 1016, 1162
Bst2UI	CCWGG	2 cut(s)	405, 491
Bst4CI	ACNGT	5 cut(s)	508, 548, 887, 940, 1226
Bst6I	CTCTTC	1 cut(s)	669
BstC8I	GCNNGC	2 cut(s)	446, 789
BstDEI	CTNAG	1 cut(s)	1169
BstDSI	CCRYGG	1 cut(s)	939
BstENI	CCTNNNNNAGG	1 cut(s)	1172
BstF5I	GGATG	9 cut(s)	138, 184, 470, 547, 554, 695, 737, 1427, 1479
BstHHI	GCGC	1 cut(s)	70
BstKTI	GATC	9 cut(s)	172, 553, 751, 782, 847, 1110, 1138, 1279, 1479
BstMBI	GATC	9 cut(s)	169, 550, 748, 779, 844, 1107, 1135, 1276, 1476
BstMWI	GCNNNNNNNGC	2 cut(s)	860, 992
BstNI	CCWGG	2 cut(s)	405, 491
BstNSI	RCATGY	3 cut(s)	747, 854, 1219
BstSCI	CCNGG	2 cut(s)	403, 489
BstSFI	CTRYAG	3 cut(s)	270, 644, 1198
BstSLI	GKGCMC	2 cut(s)	817, 1024
BstV1I	GCAGC	3 cut(s)	239, 284, 1270
BstV2I	GAAGAC	1 cut(s)	1371
BstX2I	RGATCY	2 cut(s)	169, 844
BstXI	CCANNNNNNTGG	1 cut(s)	732
BstYI	RGATCY	2 cut(s)	169, 844
BsuI	GTATCC	1 cut(s)	714
BsuRI	GGCC	2 cut(s)	1167, 1407
BtgI	CCRYGG	1 cut(s)	939
BtrI	CACGTC	1 cut(s)	1189
BtsCI	GGATG	9 cut(s)	138, 184, 470, 547, 554, 695, 737, 1427, 1479
BtsI	GCAGTG	1 cut(s)	267
BtsIMutI	CAGTG	5 cut(s)	267, 553, 669, 892, 1456
BveI	ACCTGC	1 cut(s)	1138
Cac8I	GCNNGC	2 cut(s)	446, 789
CaiI	CAGNNNCTG	1 cut(s)	278
CfoI	GCGC	1 cut(s)	70
Cfr13I	GGNCC	5 cut(s)	183, 620, 649, 1127, 1304
CsiI	ACCWGGT	1 cut(s)	403
Csp6I	GTAC	3 cut(s)	509, 1087, 1450
CviAII	CATG	6 cut(s)	45, 691, 744, 851, 877, 1216
CviQI	GTAC	3 cut(s)	509, 1087, 1450
DdeI	CTNAG	1 cut(s)	1169
DpnI	GATC	9 cut(s)	171, 552, 750, 781, 846, 1109, 1137, 1278, 1478
DpnII	GATC	9 cut(s)	169, 550, 748, 779, 844, 1107, 1135, 1276, 1476
DraIII	CACNNNGTG	1 cut(s)	407
EaeI	YGGCCR	1 cut(s)	1405
Eam1104I	CTCTTC	1 cut(s)	669
EarI	CTCTTC	1 cut(s)	669
Ecl136II	GAGCTC	1 cut(s)	1147
Eco130I	CCWWGG	4 cut(s)	186, 792, 1016, 1162
Eco147I	AGGCCT	1 cut(s)	1167
Eco24I	GRGCYC	1 cut(s)	1149
Eco47I	GGWCC	5 cut(s)	183, 620, 649, 1127, 1304
Eco53kI	GAGCTC	1 cut(s)	1147
Eco57I	CTGAAG	2 cut(s)	197, 693
Eco88I	CYCGRG	1 cut(s)	532
EcoICRI	GAGCTC	1 cut(s)	1147
EcoNI	CCTNNNNNAGG	1 cut(s)	1172
EcoO109I	RGGNCCY	1 cut(s)	1127
EcoRII	CCWGG	2 cut(s)	403, 489
EcoT14I	CCWWGG	4 cut(s)	186, 792, 1016, 1162
EcoT38I	GRGCYC	1 cut(s)	1149
ErhI	CCWWGG	4 cut(s)	186, 792, 1016, 1162
FaeI	CATG	6 cut(s)	48, 694, 747, 854, 880, 1219
FaqI	GGGAC	2 cut(s)	196, 1140
FatI	CATG	6 cut(s)	44, 690, 743, 850, 876, 1215
Fnu4HI	GCNGC	3 cut(s)	228, 273, 1284
FokI	GGATG	9 cut(s)	145, 191, 457, 541, 554, 682, 744, 1434, 1486
FriOI	GRGCYC	1 cut(s)	1149
Fsp4HI	GCNGC	3 cut(s)	228, 273, 1284
FspBI	CTAG	3 cut(s)	959, 1037, 1394
GlaI	GCGC	1 cut(s)	69
GluI	GCNGC	3 cut(s)	228, 273, 1284
GsuI	CTGGAG	2 cut(s)	473, 1480
HaeIII	GGCC	2 cut(s)	1167, 1407
HapII	CCGG	2 cut(s)	623, 655
HhaI	GCGC	1 cut(s)	70
Hin1II	CATG	6 cut(s)	48, 694, 747, 854, 880, 1219
Hin6I	GCGC	1 cut(s)	68
HinP1I	GCGC	1 cut(s)	68
HindIII	AAGCTT	2 cut(s)	209, 861
HinfI	GANTC	6 cut(s)	100, 245, 457, 687, 920, 1033
HpaII	CCGG	2 cut(s)	623, 655
HphI	GGTGA	4 cut(s)	254, 419, 605, 847
Hpy166II	GTNNAC	2 cut(s)	204, 1089
Hpy188I	TCNGA	9 cut(s)	216, 280, 426, 502, 686, 992, 1213, 1276, 1300
Hpy188III	TCNNGA	4 cut(s)	623, 908, 1037, 1480
Hpy8I	GTNNAC	2 cut(s)	204, 1089
Hpy99I	CGWCG	1 cut(s)	1250
HpyAV	CCTTC	2 cut(s)	150, 826
HpyCH4III	ACNGT	5 cut(s)	508, 548, 887, 940, 1226
HpyCH4IV	ACGT	2 cut(s)	1188, 1245
HpyF10VI	GCNNNNNNNGC	2 cut(s)	860, 992
HpyF3I	CTNAG	1 cut(s)	1169
HpySE526I	ACGT	2 cut(s)	1188, 1245
Hsp92II	CATG	6 cut(s)	48, 694, 747, 854, 880, 1219
HspAI	GCGC	1 cut(s)	68
Kpn2I	TCCGGA	1 cut(s)	622
Kzo9I	GATC	9 cut(s)	169, 550, 748, 779, 844, 1107, 1135, 1276, 1476
LmnI	GCTCC	5 cut(s)	992, 1144, 1152, 1352, 1461
Lsp1109I	GCAGC	3 cut(s)	239, 284, 1270
LweI	GCATC	4 cut(s)	388, 479, 1063, 1364
MabI	ACCWGGT	1 cut(s)	403
MaeI	CTAG	3 cut(s)	959, 1037, 1394
MaeII	ACGT	2 cut(s)	1188, 1245
MaeIII	GTNAC	3 cut(s)	407, 1030, 1288
MalI	GATC	9 cut(s)	171, 552, 750, 781, 846, 1109, 1137, 1278, 1478
MboI	GATC	9 cut(s)	169, 550, 748, 779, 844, 1107, 1135, 1276, 1476
MboII	GAAGA	2 cut(s)	686, 1376
MfeI	CAATTG	1 cut(s)	194
MflI	RGATCY	2 cut(s)	169, 844
MhlI	GDGCHC	3 cut(s)	817, 1024, 1149
MluCI	AATT	5 cut(s)	194, 316, 911, 1051, 1501
MlyI	GAGTC	1 cut(s)	1027
MmeI	TCCRAC	4 cut(s)	110, 709, 723, 776
MroI	TCCGGA	1 cut(s)	622
MroXI	GAANNNNTTC	1 cut(s)	420
MseI	TTAA	3 cut(s)	89, 261, 1004
MslI	CAYNNNNRTG	1 cut(s)	1187
MspI	CCGG	2 cut(s)	623, 655
MspR9I	CCNGG	2 cut(s)	405, 491
MunI	CAATTG	1 cut(s)	194
Mva1269I	GAATGC	2 cut(s)	462, 715
MvaI	CCWGG	2 cut(s)	405, 491
MwoI	GCNNNNNNNGC	2 cut(s)	860, 992
NdeII	GATC	9 cut(s)	169, 550, 748, 779, 844, 1107, 1135, 1276, 1476
NlaIII	CATG	6 cut(s)	48, 694, 747, 854, 880, 1219
NlaIV	GGNNCC	6 cut(s)	184, 373, 1023, 1128, 1306, 1463
NmuCI	GTSAC	3 cut(s)	407, 1030, 1288
NspI	RCATGY	3 cut(s)	747, 854, 1219
PceI	AGGCCT	1 cut(s)	1167
PciI	ACATGT	1 cut(s)	1215
PcsI	WCGNNNNNNNCGW	1 cut(s)	996
PctI	GAATGC	2 cut(s)	462, 715
PdmI	GAANNNNTTC	1 cut(s)	420
PfeI	GAWTC	5 cut(s)	100, 245, 457, 687, 920
PkrI	GCNGC	3 cut(s)	229, 274, 1285
PleI	GAGTC	1 cut(s)	1027
PpsI	GAGTC	1 cut(s)	1027
PpuMI	RGGWCCY	1 cut(s)	1127
PscI	ACATGT	1 cut(s)	1215
PshBI	ATTAAT	1 cut(s)	261
Psp124BI	GAGCTC	1 cut(s)	1149
Psp5II	RGGWCCY	1 cut(s)	1127
Psp6I	CCWGG	2 cut(s)	403, 489
PspGI	CCWGG	2 cut(s)	403, 489
PspN4I	GGNNCC	6 cut(s)	184, 373, 1023, 1128, 1306, 1463
PspPI	GGNCC	5 cut(s)	183, 620, 649, 1127, 1304
PspPPI	RGGWCCY	1 cut(s)	1127
PstI	CTGCAG	2 cut(s)	274, 648
PstNI	CAGNNNCTG	1 cut(s)	278
PsuI	RGATCY	2 cut(s)	169, 844
RsaI	GTAC	3 cut(s)	510, 1088, 1451
RsaNI	GTAC	3 cut(s)	509, 1087, 1450
RseI	CAYNNNNRTG	1 cut(s)	1187
SacI	GAGCTC	1 cut(s)	1149
SaqAI	TTAA	3 cut(s)	89, 261, 1004
SatI	GCNGC	3 cut(s)	228, 273, 1284
Sau3AI	GATC	9 cut(s)	169, 550, 748, 779, 844, 1107, 1135, 1276, 1476
Sau96I	GGNCC	5 cut(s)	183, 620, 649, 1127, 1304
SbfI	CCTGCAGG	1 cut(s)	648
SchI	GAGTC	1 cut(s)	1027
ScrFI	CCNGG	2 cut(s)	405, 491
SdaI	CCTGCAGG	1 cut(s)	648
SduI	GDGCHC	3 cut(s)	817, 1024, 1149
SexAI	ACCWGGT	1 cut(s)	403
SfaNI	GCATC	4 cut(s)	388, 479, 1063, 1364
SfcI	CTRYAG	3 cut(s)	270, 644, 1198
SinI	GGWCC	5 cut(s)	183, 620, 649, 1127, 1304
SmiMI	CAYNNNNRTG	1 cut(s)	1187
SmlI	CTYRAG	2 cut(s)	636, 1093
SmoI	CTYRAG	2 cut(s)	636, 1093
Sse8387I	CCTGCAGG	1 cut(s)	648
Sse9I	AATT	5 cut(s)	194, 316, 911, 1051, 1501
SseBI	AGGCCT	1 cut(s)	1167
SsiI	CCGC	1 cut(s)	1120
SspMI	CTAG	3 cut(s)	959, 1037, 1394
SstI	GAGCTC	1 cut(s)	1149
StuI	AGGCCT	1 cut(s)	1167
StyD4I	CCNGG	2 cut(s)	403, 489
StyI	CCWWGG	4 cut(s)	186, 792, 1016, 1162
TaaI	ACNGT	5 cut(s)	508, 548, 887, 940, 1226
TaiI	ACGT	2 cut(s)	1191, 1248
TaqI	TCGA	5 cut(s)	331, 999, 1138, 1248, 1479
TasI	AATT	5 cut(s)	194, 316, 911, 1051, 1501
TatI	WGTACW	2 cut(s)	1086, 1449
TfiI	GAWTC	5 cut(s)	100, 245, 457, 687, 920
Tru1I	TTAA	3 cut(s)	89, 261, 1004
Tru9I	TTAA	3 cut(s)	89, 261, 1004
TscAI	CASTG	5 cut(s)	274, 553, 676, 892, 1463
TseFI	GTSAC	3 cut(s)	407, 1030, 1288
TseI	GCWGC	3 cut(s)	227, 272, 1283
Tsp45I	GTSAC	3 cut(s)	407, 1030, 1288
TspDTI	ATGAA	6 cut(s)	51, 149, 168, 327, 679, 1243
TspGWI	ACGGA	1 cut(s)	547
TspRI	CASTG	5 cut(s)	274, 553, 676, 892, 1463
VpaK11BI	GGWCC	5 cut(s)	183, 620, 649, 1127, 1304
VspI	ATTAAT	1 cut(s)	261
XagI	CCTNNNNNAGG	1 cut(s)	1172
XapI	RAATTY	2 cut(s)	316, 911
XbaI	TCTAGA	1 cut(s)	1036
XceI	RCATGY	3 cut(s)	747, 854, 1219
XcmI	CCANNNNNNNNNTGG	2 cut(s)	608, 732
XmnI	GAANNNNTTC	1 cut(s)	420
XspI	CTAG	3 cut(s)	959, 1037, 1394

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.