Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002784.1

Orthogroup ID

OG0001643

Physical Location & Seq

Genomic Coordinates Reverse (-)

221550 .. 222358

Gene Structure 809 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002784.1_g000052.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 384 bp

atggtcactgctttctgtattatggaaaagtttgagtatcgtagtggaaaacatagtgttgatgatattgtgcaaaagtttcttccagaaaactttacgattatactattccattatgatgggaatgttaaagggtggtgggatcttgagtggagtaaccaggccatacacatagttgcccacaaccaaacaaagtggtggtttgcaaaacgatttctacatccagatgttgtgtccatttatgattacatattcctttgggatgaagatttgggggttgaggattttaaaggtattattctggtgttatatacccttaattacaatagtcagtttagagagttatttgaatacatgctggaatatccaaagaaaatgttatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF707

Protein Analysis

127

Amino Acids

15.47

Weight (kDa)

5.25

Isoelectric Point (pI)

33.56

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001643)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G11170 AT1G11170 AT1G11170 AT1G11170 AT1G11170 AT1G11170 AT1G11170 AT1G11170 AT1G11170 AT1G61240 AT1G61240 AT1G61240 AT1G61240 AT1G61240 AT1G61240 AT1G61240 AT1G61240
fragaria_vesca	FvH4_3g04460 FvH4_3g04460 FvH4_3g04460 FvH4_3g04460 FvH4_3g04460
malus_domestica	MD05G1323000.v1.1 MD10G1300800.v1.1
prunus_persica	Prupe.4G039600_v2.0.a1 Prupe.4G039600_v2.0.a1
pyrus_communis	pycom05g29730 pycom10g25370
rosa_chinensis	RchiOBHm_Chr3g0480871 RchiOBHm_Chr5g0006851
rosa_laevigata	RLG00000031434
rosa_multiflora	Rmu_sc0001044.1_g000034 Rmu_sc0002784.1_g000052 Rmu_sc0005956.1_g000005 Rmu_sc0012775.1_g000005
rosa_roxburghii	Rroxscaffold_1G00069200
rosa_rugosa	Rorug01G0182100 Rorug04G0425000 Rorug04G0425100.1
rosa_samantha	Rh5AG052700 Rh5AG052800 Rh5AG071100 Rh5AG371700 Rh5AG433400 Rh5BG051700 Rh5CG060300 Rh5DG050900
rosa_wichuraiana	Rw4G022980 Rw5G005190

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	150
AgsI	TTSAA	1 cut(s)	350
AjnI	CCWGG	1 cut(s)	159
AlwI	GGATC	1 cut(s)	150
AoxI	GGCC	1 cut(s)	162
BccI	CCATC	1 cut(s)	113
BciT130I	CCWGG	1 cut(s)	161
Bme1390I	CCNGG	1 cut(s)	161
BmrFI	CCNGG	1 cut(s)	161
BpuEI	CTTGAG	1 cut(s)	167
BseBI	CCWGG	1 cut(s)	161
BseGI	GGATG	2 cut(s)	220, 268
BshFI	GGCC	1 cut(s)	164
BsnI	GGCC	1 cut(s)	164
Bsp143I	GATC	1 cut(s)	142
BspANI	GGCC	1 cut(s)	164
BspPI	GGATC	1 cut(s)	150
BssMI	GATC	1 cut(s)	142
Bst2UI	CCWGG	1 cut(s)	161
BstF5I	GGATG	2 cut(s)	220, 268
BstKTI	GATC	1 cut(s)	145
BstMBI	GATC	1 cut(s)	142
BstNI	CCWGG	1 cut(s)	161
BstNSI	RCATGY	1 cut(s)	358
BstSCI	CCNGG	1 cut(s)	159
BstX2I	RGATCY	1 cut(s)	142
BstXI	CCANNNNNNTGG	1 cut(s)	119
BstYI	RGATCY	1 cut(s)	142
BsuRI	GGCC	1 cut(s)	164
BtsCI	GGATG	2 cut(s)	220, 268
BtsI	GCAGTG	1 cut(s)	6
BtsIMutI	CAGTG	1 cut(s)	6
CspCI	CAANNNNNGTGG	2 cut(s)	176, 211
CviAII	CATG	1 cut(s)	355
CviJI	RGCY	1 cut(s)	164
CviKI_1	RGCY	1 cut(s)	164
DpnI	GATC	1 cut(s)	144
DpnII	GATC	1 cut(s)	142
DraI	TTTAAA	1 cut(s)	289
EcoRII	CCWGG	1 cut(s)	159
FaeI	CATG	1 cut(s)	358
FatI	CATG	1 cut(s)	354
FokI	GGATG	2 cut(s)	207, 275
HaeIII	GGCC	1 cut(s)	164
Hin1II	CATG	1 cut(s)	358
Hpy188III	TCNNGA	3 cut(s)	86, 146, 224
HpyCH4V	TGCA	2 cut(s)	73, 206
Hsp92II	CATG	1 cut(s)	358
Kzo9I	GATC	1 cut(s)	142
LpnPI	CCDG	6 cut(s)	99, 146, 173, 237, 287, 344
MaeIII	GTNAC	2 cut(s)	4, 155
MalI	GATC	1 cut(s)	144
MboI	GATC	1 cut(s)	142
MboII	GAAGA	2 cut(s)	74, 278
MflI	RGATCY	1 cut(s)	142
MluCI	AATT	1 cut(s)	319
MnlI	CCTC	1 cut(s)	274
MseI	TTAA	3 cut(s)	129, 288, 318
MslI	CAYNNNNRTG	2 cut(s)	117, 225
MspR9I	CCNGG	1 cut(s)	161
MvaI	CCWGG	1 cut(s)	161
NdeII	GATC	1 cut(s)	142
NlaIII	CATG	1 cut(s)	358
NmuCI	GTSAC	1 cut(s)	4
NspI	RCATGY	1 cut(s)	358
Psp6I	CCWGG	1 cut(s)	159
PspGI	CCWGG	1 cut(s)	159
PsuI	RGATCY	1 cut(s)	142
RseI	CAYNNNNRTG	2 cut(s)	117, 225
SaqAI	TTAA	3 cut(s)	129, 288, 318
Sau3AI	GATC	1 cut(s)	142
ScrFI	CCNGG	1 cut(s)	161
SetI	ASST	1 cut(s)	295
SgeI	CNNG	8 cut(s)	98, 158, 172, 173, 236, 314, 367, 371
SmiMI	CAYNNNNRTG	2 cut(s)	117, 225
SmlI	CTYRAG	1 cut(s)	146
SmoI	CTYRAG	1 cut(s)	146
Sse9I	AATT	1 cut(s)	319
StyD4I	CCNGG	1 cut(s)	159
TasI	AATT	1 cut(s)	319
Tru1I	TTAA	3 cut(s)	129, 288, 318
Tru9I	TTAA	3 cut(s)	129, 288, 318
TscAI	CASTG	1 cut(s)	13
TseFI	GTSAC	1 cut(s)	4
Tsp45I	GTSAC	1 cut(s)	4
TspDTI	ATGAA	1 cut(s)	279
TspRI	CASTG	1 cut(s)	13
XceI	RCATGY	1 cut(s)	358

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.