Rh5AG371700

Protein of unknown function (DUF707)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
OG0001643
Physical Location & Seq
Reverse (-)
63140185 .. 63142994
2810 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG371700.1

Sequence Viewer

Length: 339 bp
ATGGAAGAAAGAATGCATCCCTTTAATCAGGAAATTCTTTTGAGCTCCAGAAAGTTGGACGCTGGTATTAAGCGGAAACATAGTGTTGATGATATTGTGCAAAAGTTTCTTCCAGAAAACTTTATGATTATACTATTCCATTATGATGGGAATGTTAAAGGGTGGTGGGATCTTGAGTGGAGTAACCAGGCCATACACATAGTTGCCCACAACCAAACAAAGTGGTGGTTTGCAAAACGATTTCTACATCCAGATGTTGTGTCCATTTATGATTACATATTCCTTTGGGATGAAGATTTGGGGGTTGAGGATTTTAAAGGACAGATATGGTATCATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF707

Protein Analysis

112

Amino Acids

13.66

Weight (kDa)

5.73

Isoelectric Point (pI)

45.79

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF707 PF05212 19 - 108 2.8e-45 Protein of unknown function (DUF707)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 73
AclWI GGATC 1 cut(s) 177
AcsI RAATTY 1 cut(s) 33
AjnI CCWGG 1 cut(s) 186
AluBI AGCT 1 cut(s) 45
AluI AGCT 1 cut(s) 45
Alw21I GWGCWC 1 cut(s) 47
AlwI GGATC 1 cut(s) 177
AoxI GGCC 1 cut(s) 189
ApoI RAATTY 1 cut(s) 33
BanII GRGCYC 1 cut(s) 47
Bbv12I GWGCWC 1 cut(s) 47
BccI CCATC 1 cut(s) 140
BciT130I CCWGG 1 cut(s) 188
Bme1390I CCNGG 1 cut(s) 188
BmrFI CCNGG 1 cut(s) 188
BmsI GCATC 1 cut(s) 25
BpmI CTGGAG 1 cut(s) 31
BpuEI CTTGAG 1 cut(s) 194
BseBI CCWGG 1 cut(s) 188
BseGI GGATG 3 cut(s) 16, 247, 295
BshFI GGCC 1 cut(s) 191
BsiHKAI GWGCWC 1 cut(s) 47
BsmI GAATGC 1 cut(s) 18
BsnI GGCC 1 cut(s) 191
Bsp1286I GDGCHC 1 cut(s) 47
Bsp143I GATC 1 cut(s) 169
BspACI CCGC 1 cut(s) 73
BspANI GGCC 1 cut(s) 191
BspPI GGATC 1 cut(s) 177
BssMI GATC 1 cut(s) 169
Bst2UI CCWGG 1 cut(s) 188
BstF5I GGATG 3 cut(s) 16, 247, 295
BstKTI GATC 1 cut(s) 172
BstMBI GATC 1 cut(s) 169
BstNI CCWGG 1 cut(s) 188
BstSCI CCNGG 1 cut(s) 186
BstX2I RGATCY 1 cut(s) 169
BstXI CCANNNNNNTGG 2 cut(s) 55, 146
BstYI RGATCY 1 cut(s) 169
BsuRI GGCC 1 cut(s) 191
BtsCI GGATG 3 cut(s) 16, 247, 295
CseI GACGC 1 cut(s) 68
CspCI CAANNNNNGTGG 2 cut(s) 203, 238
CviJI RGCY 2 cut(s) 45, 191
CviKI_1 RGCY 2 cut(s) 45, 191
DpnI GATC 1 cut(s) 171
DpnII GATC 1 cut(s) 169
DraI TTTAAA 1 cut(s) 316
Ecl136II GAGCTC 1 cut(s) 45
Eco24I GRGCYC 1 cut(s) 47
Eco53kI GAGCTC 1 cut(s) 45
EcoICRI GAGCTC 1 cut(s) 45
EcoRII CCWGG 1 cut(s) 186
EcoT22I ATGCAT 1 cut(s) 18
EcoT38I GRGCYC 1 cut(s) 47
FaiI YATR 9 cut(s) 81, 125, 131, 144, 194, 200, 270, 278, 328
FokI GGATG 3 cut(s) 3, 234, 302
FriOI GRGCYC 1 cut(s) 47
GsuI CTGGAG 1 cut(s) 31
HaeIII GGCC 1 cut(s) 191
HgaI GACGC 1 cut(s) 68
Hpy188III TCNNGA 5 cut(s) 29, 48, 113, 173, 251
HpyCH4V TGCA 3 cut(s) 16, 100, 233
Kzo9I GATC 1 cut(s) 169
LmnI GCTCC 1 cut(s) 50
LpnPI CCDG 7 cut(s) 14, 48, 61, 126, 173, 200, 264
LweI GCATC 1 cut(s) 25
MaeIII GTNAC 1 cut(s) 182
MalI GATC 1 cut(s) 171
MboI GATC 1 cut(s) 169
MboII GAAGA 3 cut(s) 17, 101, 305
MflI RGATCY 1 cut(s) 169
MhlI GDGCHC 1 cut(s) 47
MluCI AATT 1 cut(s) 33
MmeI TCCRAC 1 cut(s) 36
MnlI CCTC 1 cut(s) 301
Mph1103I ATGCAT 1 cut(s) 18
MseI TTAA 5 cut(s) 24, 69, 156, 315, 337
MslI CAYNNNNRTG 2 cut(s) 144, 252
MspR9I CCNGG 1 cut(s) 188
Mva1269I GAATGC 1 cut(s) 18
MvaI CCWGG 1 cut(s) 188
NdeII GATC 1 cut(s) 169
NsiI ATGCAT 1 cut(s) 18
PctI GAATGC 1 cut(s) 18
Psp124BI GAGCTC 1 cut(s) 47
Psp6I CCWGG 1 cut(s) 186
PspGI CCWGG 1 cut(s) 186
PsuI RGATCY 1 cut(s) 169
RseI CAYNNNNRTG 2 cut(s) 144, 252
SacI GAGCTC 1 cut(s) 47
SaqAI TTAA 5 cut(s) 24, 69, 156, 315, 337
Sau3AI GATC 1 cut(s) 169
ScrFI CCNGG 1 cut(s) 188
SduI GDGCHC 1 cut(s) 47
SetI ASST 1 cut(s) 47
SfaNI GCATC 1 cut(s) 25
SgeI CNNG 8 cut(s) 41, 60, 75, 125, 185, 199, 200, 263
SmiMI CAYNNNNRTG 2 cut(s) 144, 252
SmlI CTYRAG 1 cut(s) 173
SmoI CTYRAG 1 cut(s) 173
Sse9I AATT 1 cut(s) 33
SsiI CCGC 1 cut(s) 73
SstI GAGCTC 1 cut(s) 47
StyD4I CCNGG 1 cut(s) 186
TasI AATT 1 cut(s) 33
Tru1I TTAA 5 cut(s) 24, 69, 156, 315, 337
Tru9I TTAA 5 cut(s) 24, 69, 156, 315, 337
TspDTI ATGAA 1 cut(s) 306
XapI RAATTY 1 cut(s) 33
Zsp2I ATGCAT 1 cut(s) 18
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.