Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004536.1

Orthogroup ID

OG0002623

Physical Location & Seq

Genomic Coordinates Reverse (-)

4201 .. 4740

Gene Structure 540 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004536.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 540 bp

atggagggaagttctagcagtgatgagttgtccaagatcagcctgaggccattggctctttcggacatcgatgatttcatggtctgggccactgatgaaaaagtgtctcgcttctgcacttgggagccttacaccagcaaagaagatggcattaaattcatcaaggaacaggttctcccacacccctggtacagggcaatctgcctagacaacaagccaattggctccatttcggtgtcctcaaaatcggggaatgatcgttgtagaggtgaactcggctatgttttggggtccaagtactgggggaaagggattgcaacacaagctgtgaaaatggtggctgatactatatttaaagaatggactcatttggagagacttgaagctcttgttgatgtgaacaatgtgcgatcacagagggttctggagaaggccgggttcctgaaggaaggtgttctcagaaaatatgaagttttgaagggaagaacttgggatatagtgatgtatagtcttctttctacagatcgatgtcaaacttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Acetyltransf_3

Protein Analysis

179

Amino Acids

20.39

Weight (kDa)

7.62

Isoelectric Point (pI)

12.59

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002623)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G32020 AT2G32030
fragaria_vesca	FvH4_4g16130 FvH4_4g16140 FvH4_4g26600
malus_domestica	MD13G1195600.v1.1 MD16G1196400.v1.1 MD16G1196500.v1.1
prunus_persica	Prupe.1G016600_v2.0.a1 Prupe.1G016700_v2.0.a1
pyrus_communis	pycom13g16790
rosa_chinensis	RchiOBHm_Chr4g0415651 RchiOBHm_Chr4g0415661 RchiOBHm_Chr4g0415691
rosa_laevigata	RLG00000008050 RLG00000008051 RLG00000008052
rosa_multiflora	Rmu_co8195074.1_g000001 Rmu_sc0004536.1_g000001 Rmu_sc0004536.1_g000002 Rmu_sc0004540.1_g000030
rosa_roxburghii	Rroxscaffold_5G00355360 Rroxscaffold_5G00355390 Rroxscaffold_5G00359480 Rroxscaffold_5G00359500
rosa_rugosa	Rorug04G0113500 Rorug04G0113500 Rorug04G0136100 Rorug04G0136200
rosa_samantha	Rh4AG197000 Rh4AG197100 Rh4BG195500 Rh4BG195600 Rh4CG207700 Rh4CG207900 Rh4CG208200 Rh4DG194800 Rh4DG194900
rosa_wichuraiana	Rw4G016750 Rw4G016760

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	300
AcsI	RAATTY	1 cut(s)	155
AcuI	CTGAAG	1 cut(s)	464
AfaI	GTAC	2 cut(s)	191, 299
AfiI	CCNNNNNNNGG	2 cut(s)	192, 300
AgsI	TTSAA	2 cut(s)	383, 478
AjnI	CCWGG	1 cut(s)	185
AloI	GAACNNNNNNTCC	2 cut(s)	159, 191
AluBI	AGCT	2 cut(s)	326, 386
AluI	AGCT	2 cut(s)	326, 386
Alw26I	GTCTC	2 cut(s)	111, 370
AoxI	GGCC	3 cut(s)	47, 87, 432
ApoI	RAATTY	1 cut(s)	155
Asp700I	GAANNNNTTC	2 cut(s)	171, 453
AspS9I	GGNCC	2 cut(s)	87, 291
AsuC2I	CCSGG	1 cut(s)	436
AsuHPI	GGTGA	1 cut(s)	281
AvaII	GGWCC	1 cut(s)	291
AxyI	CCTNAGG	1 cut(s)	44
BbsI	GAAGAC	1 cut(s)	503
BccI	CCATC	1 cut(s)	140
BciT130I	CCWGG	1 cut(s)	187
BcnI	CCSGG	1 cut(s)	436
BcoDI	GTCTC	2 cut(s)	111, 370
BfaI	CTAG	2 cut(s)	15, 206
BfmI	CTRYAG	1 cut(s)	519
BmcAI	AGTACT	1 cut(s)	299
Bme1390I	CCNGG	2 cut(s)	187, 436
Bme18I	GGWCC	1 cut(s)	291
BmgT120I	GGNCC	2 cut(s)	87, 291
BmiI	GGNNCC	4 cut(s)	126, 226, 292, 440
BmrFI	CCNGG	2 cut(s)	187, 436
BmrI	ACTGGG	1 cut(s)	310
BmuI	ACTGGG	1 cut(s)	310
BpiI	GAAGAC	1 cut(s)	503
BplI	GAGNNNNNCTC	2 cut(s)	258, 290
BpmI	CTGGAG	1 cut(s)	446
BpuMI	CCSGG	1 cut(s)	436
Bsa29I	ATCGAT	2 cut(s)	69, 526
BsaJI	CCNNGG	1 cut(s)	185
BsaXI	ACNNNNNCTCC	2 cut(s)	159, 189
Bsc4I	CCNNNNNNNGG	2 cut(s)	192, 300
Bse1I	ACTGG	1 cut(s)	305
Bse21I	CCTNAGG	1 cut(s)	44
BseBI	CCWGG	1 cut(s)	187
BseCI	ATCGAT	2 cut(s)	69, 526
BseDI	CCNNGG	1 cut(s)	185
BseLI	CCNNNNNNNGG	2 cut(s)	192, 300
BseMII	CTCAG	2 cut(s)	35, 472
BseNI	ACTGG	1 cut(s)	305
BsgI	GTGCAG	1 cut(s)	100
BshFI	GGCC	3 cut(s)	49, 89, 434
BshVI	ATCGAT	2 cut(s)	69, 526
BsiSI	CCGG	1 cut(s)	435
BslI	CCNNNNNNNGG	2 cut(s)	192, 300
BsmAI	GTCTC	2 cut(s)	111, 370
BsnI	GGCC	3 cut(s)	49, 89, 434
Bsp143I	GATC	4 cut(s)	36, 256, 410, 523
BspANI	GGCC	3 cut(s)	49, 89, 434
BspCNI	CTCAG	2 cut(s)	36, 471
BspDI	ATCGAT	2 cut(s)	69, 526
BspLI	GGNNCC	4 cut(s)	126, 226, 292, 440
BsrI	ACTGG	1 cut(s)	305
BssECI	CCNNGG	1 cut(s)	185
BssMI	GATC	4 cut(s)	36, 256, 410, 523
Bst2UI	CCWGG	1 cut(s)	187
BstDEI	CTNAG	2 cut(s)	44, 458
BstENI	CCTNNNNNAGG	1 cut(s)	190
BstKTI	GATC	4 cut(s)	39, 259, 413, 526
BstMAI	GTCTC	2 cut(s)	111, 370
BstMBI	GATC	4 cut(s)	36, 256, 410, 523
BstMWI	GCNNNNNNNGC	1 cut(s)	323
BstNI	CCWGG	1 cut(s)	187
BstSCI	CCNGG	2 cut(s)	185, 434
BstSFI	CTRYAG	1 cut(s)	519
BstV2I	GAAGAC	1 cut(s)	503
BstXI	CCANNNNNNTGG	1 cut(s)	186
Bsu15I	ATCGAT	2 cut(s)	69, 526
Bsu36I	CCTNAGG	1 cut(s)	44
BsuRI	GGCC	3 cut(s)	49, 89, 434
BsuTUI	ATCGAT	2 cut(s)	69, 526
BtsI	GCAGTG	1 cut(s)	25
BtsIMutI	CAGTG	2 cut(s)	25, 90
Cfr13I	GGNCC	2 cut(s)	87, 291
ClaI	ATCGAT	2 cut(s)	69, 526
Csp6I	GTAC	2 cut(s)	190, 298
CviAII	CATG	1 cut(s)	79
CviQI	GTAC	2 cut(s)	190, 298
DdeI	CTNAG	2 cut(s)	44, 458
DpnI	GATC	4 cut(s)	38, 258, 412, 525
DpnII	GATC	4 cut(s)	36, 256, 410, 523
DraI	TTTAAA	1 cut(s)	355
Eco47I	GGWCC	1 cut(s)	291
Eco57I	CTGAAG	1 cut(s)	464
Eco81I	CCTNAGG	1 cut(s)	44
EcoNI	CCTNNNNNAGG	1 cut(s)	190
EcoRII	CCWGG	1 cut(s)	185
FaeI	CATG	1 cut(s)	82
FaiI	YATR	6 cut(s)	80, 282, 350, 468, 497, 507
FatI	CATG	1 cut(s)	78
FspBI	CTAG	2 cut(s)	15, 206
GsuI	CTGGAG	1 cut(s)	446
HaeIII	GGCC	3 cut(s)	49, 89, 434
HapII	CCGG	1 cut(s)	435
Hin1II	CATG	1 cut(s)	82
HinfI	GANTC	1 cut(s)	364
HpaII	CCGG	1 cut(s)	435
HphI	GGTGA	1 cut(s)	281
Hpy166II	GTNNAC	2 cut(s)	272, 400
Hpy188I	TCNGA	2 cut(s)	64, 461
Hpy188III	TCNNGA	2 cut(s)	425, 442
Hpy8I	GTNNAC	2 cut(s)	272, 400
HpyAV	CCTTC	4 cut(s)	424, 439, 443, 472
HpyCH4V	TGCA	2 cut(s)	117, 317
HpyF10VI	GCNNNNNNNGC	1 cut(s)	323
HpyF3I	CTNAG	2 cut(s)	44, 458
Hsp92II	CATG	1 cut(s)	82
Kzo9I	GATC	4 cut(s)	36, 256, 410, 523
LmnI	GCTCC	2 cut(s)	124, 230
MaeI	CTAG	2 cut(s)	15, 206
MalI	GATC	4 cut(s)	38, 258, 412, 525
MboI	GATC	4 cut(s)	36, 256, 410, 523
MboII	GAAGA	3 cut(s)	155, 495, 503
MfeI	CAATTG	1 cut(s)	219
MluCI	AATT	2 cut(s)	155, 219
MlyI	GAGTC	1 cut(s)	358
MnlI	CCTC	4 cut(s)	39, 250, 260, 411
MroXI	GAANNNNTTC	2 cut(s)	171, 453
MseI	TTAA	2 cut(s)	153, 354
MslI	CAYNNNNRTG	1 cut(s)	233
MspI	CCGG	1 cut(s)	435
MspR9I	CCNGG	2 cut(s)	187, 436
MunI	CAATTG	1 cut(s)	219
MvaI	CCWGG	1 cut(s)	187
MwoI	GCNNNNNNNGC	1 cut(s)	323
NciI	CCSGG	1 cut(s)	436
NdeII	GATC	4 cut(s)	36, 256, 410, 523
NlaIII	CATG	1 cut(s)	82
NlaIV	GGNNCC	4 cut(s)	126, 226, 292, 440
NmeAIII	GCCGAG	1 cut(s)	255
PdmI	GAANNNNTTC	2 cut(s)	171, 453
PflMI	CCANNNNNTGG	1 cut(s)	300
PleI	GAGTC	1 cut(s)	358
PpsI	GAGTC	1 cut(s)	358
Psp6I	CCWGG	1 cut(s)	185
PspGI	CCWGG	1 cut(s)	185
PspN4I	GGNNCC	4 cut(s)	126, 226, 292, 440
PspPI	GGNCC	2 cut(s)	87, 291
RsaI	GTAC	2 cut(s)	191, 299
RsaNI	GTAC	2 cut(s)	190, 298
RseI	CAYNNNNRTG	1 cut(s)	233
SaqAI	TTAA	2 cut(s)	153, 354
Sau3AI	GATC	4 cut(s)	36, 256, 410, 523
Sau96I	GGNCC	2 cut(s)	87, 291
ScaI	AGTACT	1 cut(s)	299
SchI	GAGTC	1 cut(s)	358
ScrFI	CCNGG	2 cut(s)	187, 436
SetI	ASST	5 cut(s)	174, 271, 328, 388, 454
SfcI	CTRYAG	1 cut(s)	519
SinI	GGWCC	1 cut(s)	291
SmiMI	CAYNNNNRTG	1 cut(s)	233
Sse9I	AATT	2 cut(s)	155, 219
SspMI	CTAG	2 cut(s)	15, 206
StyD4I	CCNGG	2 cut(s)	185, 434
TaqI	TCGA	2 cut(s)	69, 526
TasI	AATT	2 cut(s)	155, 219
TatI	WGTACW	1 cut(s)	297
Tru1I	TTAA	2 cut(s)	153, 354
Tru9I	TTAA	2 cut(s)	153, 354
TscAI	CASTG	2 cut(s)	25, 97
TspDTI	ATGAA	4 cut(s)	67, 111, 148, 483
TspRI	CASTG	2 cut(s)	25, 97
Van91I	CCANNNNNTGG	1 cut(s)	300
VpaK11BI	GGWCC	1 cut(s)	291
XagI	CCTNNNNNAGG	1 cut(s)	190
XapI	RAATTY	1 cut(s)	155
XmnI	GAANNNNTTC	2 cut(s)	171, 453
XspI	CTAG	2 cut(s)	15, 206
ZrmI	AGTACT	1 cut(s)	299

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.