Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004755.1

Orthogroup ID

OG0002241

Physical Location & Seq

Genomic Coordinates Reverse (-)

110145 .. 111266

Gene Structure 1122 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004755.1_g000026.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1122 bp

atggttgaaccatgtcttgatgatcatttggaagctcttgttattgaagatactgtcaaggaagaggtggacgacataaaggagattgatgcagagttgttatcagaattggatacagttggagatttcagtgtgaaagaagttgttggtgagccactccattatgagttgataacagaggaagctaatgctgtgagcactgaatctgggttgtcgacggcggatccaaacccgttagagtccatccaggagctacctgttcttgagcacactcaggaggtagtagatgttgatgggactttcaaacaaattcatgagggagtcaatgttgaggaggtcatgtgtcctagcgtggttgacaatgagctagaggtagtgtcaaaaagtacagtgcaggccagttcacagttgctaacagttgaagcaacatctttggaagatattattacttcttcaaatcaagctctagacagttctgttaatgagtttccacaactattggatacagaggggtcagcaggattacatctggaattacctccagagggtaatgacgtatcagcagatgtcttgcctgatgcagaggaggagatcgcatcaggcaatataggatccagtattcaagaaactttcactacgcatattcctttgaagcaactatcagaaggtaatgttgctgagctgccaaatccatcaaattcaaaggacgtattggcagaagtaggaactgaggctgtggtggagattggatcaagcaatgttgtttatggtgttgaagaaactatcagtgattctcctttgaagcaagtctcggaagatgatgtccgtgagctgccaaaaccatcaaattcaaaggatggatgtgaagaagtaagaactatggtgggggattctatagacgagattggatcgaacaataaaggatctggtgttcaagaaactatccctactcatagtgcgttgaagcaagtctcggaaagtattgtggctgactccatagagattgcatcaggcaatagagaagttgtgcaagaacctatacctactcaagtttcagaaaagaatgttggtgttggtgagctgccaaaaccatctgattcaaatgatggattagcagaatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

373

Amino Acids

39.71

Weight (kDa)

4.05

Isoelectric Point (pI)

43.98

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002241)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G17910 AT5G17910 AT5G17910
fragaria_vesca	FvH4_1g29420 FvH4_1g29420 FvH4_1g29420 FvH4_2g10091 FvH4_2g10092
malus_domestica	MD05G1057800.v1.1 MD12G1015000.v1.1 MD14G1012900.v1.1
prunus_persica	Prupe.7G025700_v2.0.a1 Prupe.7G025700_v2.0.a1 Prupe.7G025700_v2.0.a1 Prupe.8G087600_v2.0.a1 Prupe.8G087600_v2.0.a1 Prupe.8G087600_v2.0.a1
pyrus_communis	pycom05g04890 pycom12g01220 pycom14g01090
rosa_chinensis	RchiOBHm_Chr3g0495491 RchiOBHm_Chr6g0267051
rosa_laevigata	RLG00000014046 RLG00000022616
rosa_multiflora	Rmu_co8285861.1_g000001 Rmu_sc0004755.1_g000026 Rmu_sc0005599.1_g000001 Rmu_sc0006163.1_g000016 Rmu_sc0013804.1_g000006
rosa_roxburghii	Rroxscaffold_6G00390490 Rroxscaffold_7G00201200
rosa_rugosa	Rorug03G0273800 Rorug06G0028700
rosa_samantha	Rh3AG321400 Rh3BG356700 Rh3CG353500 Rh3DG356000 Rh6AG150200 Rh6BG151100 Rh6CG146500 Rh6DG135200
rosa_wichuraiana	Rw3G028090 Rw6G013020

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	215
AciI	CCGC	1 cut(s)	221
AclWI	GGATC	7 cut(s)	218, 231, 606, 619, 757, 916, 931
AcsI	RAATTY	3 cut(s)	309, 697, 847
AfaI	GTAC	1 cut(s)	388
AfiI	CCNNNNNNNGG	1 cut(s)	545
AjnI	CCWGG	1 cut(s)	246
AjuI	GAANNNNNNNTTGG	2 cut(s)	1050, 1082
AloI	GAACNNNNNNTCC	2 cut(s)	915, 947
AluBI	AGCT	8 cut(s)	35, 185, 253, 367, 464, 682, 832, 1081
AluI	AGCT	8 cut(s)	35, 185, 253, 367, 464, 682, 832, 1081
Alw21I	GWGCWC	2 cut(s)	200, 270
Alw26I	GTCTC	2 cut(s)	814, 976
AlwI	GGATC	7 cut(s)	218, 231, 606, 619, 757, 916, 931
AoxI	GGCC	1 cut(s)	396
ApeKI	GCWGC	3 cut(s)	682, 832, 1081
ApoI	RAATTY	3 cut(s)	309, 697, 847
AsuHPI	GGTGA	2 cut(s)	161, 1088
BamHI	GGATCC	2 cut(s)	223, 611
Bbv12I	GWGCWC	2 cut(s)	200, 270
BbvI	GCAGC	3 cut(s)	669, 819, 1068
BccI	CCATC	7 cut(s)	251, 287, 700, 850, 851, 1099, 1100
BceAI	ACGGC	1 cut(s)	234
BciT130I	CCWGG	1 cut(s)	248
BciVI	GTATCC	2 cut(s)	106, 496
BclI	TGATCA	1 cut(s)	22
BcoDI	GTCTC	2 cut(s)	814, 976
BfaI	CTAG	3 cut(s)	348, 368, 467
BfmI	CTRYAG	1 cut(s)	894
BfuI	GTATCC	2 cut(s)	106, 496
BisI	GCNGC	3 cut(s)	683, 833, 1082
BlpI	GCTNAGC	1 cut(s)	678
BlsI	GCNGC	3 cut(s)	684, 834, 1083
Bme1390I	CCNGG	1 cut(s)	248
BmiI	GGNNCC	2 cut(s)	225, 613
BmrFI	CCNGG	1 cut(s)	248
BmsI	GCATC	4 cut(s)	79, 568, 605, 1016
BpmI	CTGGAG	1 cut(s)	525
Bpu1102I	GCTNAGC	1 cut(s)	678
BpuEI	CTTGAG	2 cut(s)	284, 1032
BsaXI	ACNNNNNCTCC	4 cut(s)	312, 326, 342, 356
Bsc4I	CCNNNNNNNGG	1 cut(s)	545
Bse1I	ACTGG	2 cut(s)	399, 615
Bse3DI	GCAATG	1 cut(s)	763
BseBI	CCWGG	1 cut(s)	248
BseGI	GGATG	3 cut(s)	243, 862, 866
BseLI	CCNNNNNNNGG	1 cut(s)	545
BseMI	GCAATG	1 cut(s)	763
BseMII	CTCAG	3 cut(s)	287, 669, 720
BseNI	ACTGG	2 cut(s)	399, 615
BseRI	GAGGAG	3 cut(s)	347, 599, 602
BseXI	GCAGC	3 cut(s)	669, 819, 1068
BsgI	GTGCAG	1 cut(s)	413
BshFI	GGCC	1 cut(s)	398
BsiHKAI	GWGCWC	2 cut(s)	200, 270
BslFI	GGGAC	1 cut(s)	310
BslI	CCNNNNNNNGG	1 cut(s)	545
BsmAI	GTCTC	2 cut(s)	814, 976
BsmFI	GGGAC	1 cut(s)	310
BsnI	GGCC	1 cut(s)	398
Bsp1286I	GDGCHC	2 cut(s)	200, 270
Bsp143I	GATC	7 cut(s)	22, 223, 591, 611, 749, 908, 923
Bsp1720I	GCTNAGC	1 cut(s)	678
BspACI	CCGC	1 cut(s)	221
BspANI	GGCC	1 cut(s)	398
BspCNI	CTCAG	3 cut(s)	286, 670, 721
BspHI	TCATGA	1 cut(s)	313
BspLI	GGNNCC	2 cut(s)	225, 613
BspPI	GGATC	7 cut(s)	218, 231, 606, 619, 757, 916, 931
BsrDI	GCAATG	1 cut(s)	763
BsrI	ACTGG	2 cut(s)	399, 615
BssMI	GATC	7 cut(s)	22, 223, 591, 611, 749, 908, 923
Bst2UI	CCWGG	1 cut(s)	248
Bst4CI	ACNGT	6 cut(s)	55, 118, 391, 408, 418, 473
Bst6I	CTCTTC	1 cut(s)	57
BstC8I	GCNNGC	1 cut(s)	396
BstDEI	CTNAG	3 cut(s)	273, 678, 729
BstF5I	GGATG	3 cut(s)	243, 862, 866
BstKTI	GATC	7 cut(s)	25, 226, 594, 614, 752, 911, 926
BstMAI	GTCTC	2 cut(s)	814, 976
BstMBI	GATC	7 cut(s)	22, 223, 591, 611, 749, 908, 923
BstNI	CCWGG	1 cut(s)	248
BstSCI	CCNGG	1 cut(s)	246
BstSFI	CTRYAG	1 cut(s)	894
BstV1I	GCAGC	3 cut(s)	669, 819, 1068
BstX2I	RGATCY	3 cut(s)	223, 611, 923
BstYI	RGATCY	3 cut(s)	223, 611, 923
BsuI	GTATCC	2 cut(s)	106, 496
BsuRI	GGCC	1 cut(s)	398
BtsCI	GGATG	3 cut(s)	243, 862, 866
BtsIMutI	CAGTG	4 cut(s)	136, 198, 396, 793
Cac8I	GCNNGC	1 cut(s)	396
CciI	TCATGA	1 cut(s)	313
Csp6I	GTAC	1 cut(s)	387
CspCI	CAANNNNNGTGG	2 cut(s)	480, 515
CviAII	CATG	3 cut(s)	12, 314, 340
CviQI	GTAC	1 cut(s)	387
DdeI	CTNAG	3 cut(s)	273, 678, 729
DpnI	GATC	7 cut(s)	24, 225, 593, 613, 751, 910, 925
DpnII	GATC	7 cut(s)	22, 223, 591, 611, 749, 908, 923
Eam1104I	CTCTTC	1 cut(s)	57
EarI	CTCTTC	1 cut(s)	57
EciI	GGCGGA	1 cut(s)	236
EcoRII	CCWGG	1 cut(s)	246
FaeI	CATG	3 cut(s)	15, 317, 343
FaqI	GGGAC	1 cut(s)	310
FatI	CATG	3 cut(s)	11, 313, 339
FbaI	TGATCA	1 cut(s)	22
FblI	GTMKAC	1 cut(s)	215
Fnu4HI	GCNGC	3 cut(s)	683, 833, 1082
FokI	GGATG	3 cut(s)	230, 869, 873
Fsp4HI	GCNGC	3 cut(s)	683, 833, 1082
FspBI	CTAG	3 cut(s)	348, 368, 467
GluI	GCNGC	3 cut(s)	683, 833, 1082
GsuI	CTGGAG	1 cut(s)	525
HaeIII	GGCC	1 cut(s)	398
Hin1II	CATG	3 cut(s)	15, 317, 343
HincII	GTYRAC	2 cut(s)	216, 358
HindII	GTYRAC	2 cut(s)	216, 358
HinfI	GANTC	7 cut(s)	203, 239, 321, 791, 890, 992, 1097
HphI	GGTGA	2 cut(s)	161, 1088
Hpy166II	GTNNAC	4 cut(s)	70, 216, 358, 404
Hpy188I	TCNGA	6 cut(s)	106, 664, 814, 976, 1057, 1096
Hpy188III	TCNNGA	9 cut(s)	17, 263, 275, 314, 467, 530, 542, 623, 935
Hpy8I	GTNNAC	4 cut(s)	70, 216, 358, 404
Hpy99I	CGWCG	1 cut(s)	220
HpyAV	CCTTC	1 cut(s)	659
HpyCH4III	ACNGT	6 cut(s)	55, 118, 391, 408, 418, 473
HpyCH4IV	ACGT	2 cut(s)	555, 708
HpyCH4V	TGCA	5 cut(s)	92, 394, 581, 1007, 1030
HpyF3I	CTNAG	3 cut(s)	273, 678, 729
HpySE526I	ACGT	2 cut(s)	555, 708
Hsp92II	CATG	3 cut(s)	15, 317, 343
Ksp22I	TGATCA	1 cut(s)	22
Kzo9I	GATC	7 cut(s)	22, 223, 591, 611, 749, 908, 923
LmnI	GCTCC	1 cut(s)	250
Lsp1109I	GCAGC	3 cut(s)	669, 819, 1068
LweI	GCATC	4 cut(s)	79, 568, 605, 1016
MaeI	CTAG	3 cut(s)	348, 368, 467
MaeII	ACGT	2 cut(s)	555, 708
MalI	GATC	7 cut(s)	24, 225, 593, 613, 751, 910, 925
MboI	GATC	7 cut(s)	22, 223, 591, 611, 749, 908, 923
MboII	GAAGA	7 cut(s)	59, 74, 444, 449, 788, 827, 878
MflI	RGATCY	3 cut(s)	223, 611, 923
MhlI	GDGCHC	2 cut(s)	200, 270
MluCI	AATT	5 cut(s)	107, 309, 533, 697, 847
MlyI	GAGTC	3 cut(s)	248, 330, 986
MmeI	TCCRAC	1 cut(s)	100
MseI	TTAA	1 cut(s)	480
MspR9I	CCNGG	1 cut(s)	248
MvaI	CCWGG	1 cut(s)	248
NdeII	GATC	7 cut(s)	22, 223, 591, 611, 749, 908, 923
NlaIII	CATG	3 cut(s)	15, 317, 343
NlaIV	GGNNCC	2 cut(s)	225, 613
PagI	TCATGA	1 cut(s)	313
PfeI	GAWTC	4 cut(s)	203, 791, 890, 1097
PfoI	TCCNGGA	1 cut(s)	246
PkrI	GCNGC	3 cut(s)	684, 834, 1083
PleI	GAGTC	3 cut(s)	247, 329, 986
PpsI	GAGTC	3 cut(s)	247, 329, 986
Psp6I	CCWGG	1 cut(s)	246
PspGI	CCWGG	1 cut(s)	246
PspN4I	GGNNCC	2 cut(s)	225, 613
PsuI	RGATCY	3 cut(s)	223, 611, 923
RsaI	GTAC	1 cut(s)	388
RsaNI	GTAC	1 cut(s)	387
SalI	GTCGAC	1 cut(s)	214
SaqAI	TTAA	1 cut(s)	480
SatI	GCNGC	3 cut(s)	683, 833, 1082
Sau3AI	GATC	7 cut(s)	22, 223, 591, 611, 749, 908, 923
SchI	GAGTC	3 cut(s)	248, 330, 986
ScrFI	CCNGG	1 cut(s)	248
SduI	GDGCHC	2 cut(s)	200, 270
SfaNI	GCATC	4 cut(s)	79, 568, 605, 1016
SfcI	CTRYAG	1 cut(s)	894
SmlI	CTYRAG	2 cut(s)	263, 1047
SmoI	CTYRAG	2 cut(s)	263, 1047
Sse9I	AATT	5 cut(s)	107, 309, 533, 697, 847
SsiI	CCGC	1 cut(s)	221
SspMI	CTAG	3 cut(s)	348, 368, 467
StyD4I	CCNGG	1 cut(s)	246
TaaI	ACNGT	6 cut(s)	55, 118, 391, 408, 418, 473
TaiI	ACGT	2 cut(s)	558, 711
TaqI	TCGA	2 cut(s)	215, 911
TasI	AATT	5 cut(s)	107, 309, 533, 697, 847
TatI	WGTACW	1 cut(s)	386
TfiI	GAWTC	4 cut(s)	203, 791, 890, 1097
Tru1I	TTAA	1 cut(s)	480
Tru9I	TTAA	1 cut(s)	480
TscAI	CASTG	4 cut(s)	136, 205, 396, 793
TseI	GCWGC	3 cut(s)	682, 832, 1081
TspDTI	ATGAA	1 cut(s)	302
TspGWI	ACGGA	1 cut(s)	815
TspRI	CASTG	4 cut(s)	136, 205, 396, 793
XapI	RAATTY	3 cut(s)	309, 697, 847
XbaI	TCTAGA	1 cut(s)	466
XmiI	GTMKAC	1 cut(s)	215
XspI	CTAG	3 cut(s)	348, 368, 467

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.