Rmu_sc0005599.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005599.1
Physical Location & Seq
Reverse (-)
1443 .. 6309
4867 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005599.1_g000001.1.cds

Sequence Viewer

Length: 4278 bp
atggggggattagtgttggaaattggaagtcaaatcagcaagtttgtgatgatatcagtgaaaacatgttataaatcagttggcaatcatccatttgttgtgggcatcctgcttttccttatatttctgcacagatcatttcctgttttgttttctgttttggtgtcaacatcccctgttctagtctgcactgctattcttcttggaacccttttaagttttggccaatccaacatacccgaaattgaacgccaagaccatactgcttcgcttagagccagggttccaggcgatgacactgttgttcttgagaggggtggcagcttttccacagagaaattctctgcgagcagggatgttgtcgacgccgtggcccttgaagaagccggctcgacagattacacagtcaatgatgaggttgttgcgccacttattaatcagaatgtgcagcagactcagactgacgagagagtggttgaggatgtggacagagacatagagttggaaaatcagggcttgccgaatgatgtggaagcagttgagcagcagtatactttgcttcaaaaggttcgagatcagattctccaagtgcacgatgataatgtgtctccccgaggaggaggagaacacttggattcctttctgggtggctacggtcatgatgacagtggtgatgcttctgattccgggtcggatggggctgagagctcgtcgccagatgcttcaatggctgacatccttccaattcttgatgagctacacccgcttttagactcagaagctccacagcctgctcgtatgttgcatgatggatctgatgcagcttcagatagtagtgttgagtcggaccagggtggacaagtagatgaggatgatggggttgattacaatggcggagatgaggaagaagtaccggcacacggtggcacagatgatgaaagcaaatctgcaattaagtggacagatgatgaccaaaagaatctcatggatttgggaaatttggagcttgaaaggaaccaacgcttggagagtcttattgcaaggagaagggcaagaaaaagcttcaaattaacggctgagaagaatctaatagattttgatggtgttgatcttccctttaatgtttcaccaatttcaacaacaaggcgcaacccattcgattctccatttgatgactcctatggcaacatgcccatccctggttctgctccatccattatgttggcaaggagaaatccttttgatcttccttatgactccaatgaagaaaaacctgacctcaagggagaccatttcgagcaagagtttattgcatcgcatgccaacgatgcattcttccgtaggcatgaaagcttcagtttgggagcttcaagcttggggggtgccaagcacgagaggcaagaatttaagtggaaacctgttttcataccagaaagattggcttcagaaggaacaggttactcctcatttcaaagacaatcaagtgaagttagtgaatcaaagttgagttctgttcctgatagcgactcggtgagttctgtagcagatttggatgataggaagttcagtgagcaagactttactaaagaaacggaagttatctccaacatttatcatgcatctggtcttgttgaccatggaagtcattcctatgaagacgtatattccctggaaatggaacaggctgacaaaagggatgtcctacacaatgggcttgatatagaattgggtaaaagggaaaatctggaaccaagcttgtcggataatggaggcttaccttctgttgttactaatgaactccatctgaatccagaattagttgaagaggaggacaacagcagtaggtcaagcttgtcatcattgtcagaagcagatgaaaaaatttcagacgtgaggaagggtgaaaaaagttcggacccaagtggtgatctcaacaaggagtttctaatttcaccacaacattcacttgaggagtcaagtgttcaattcatgagcacgacagctgatgaaaatcaatttaaggagccagtctacgactcaactccccttgacgcagaaaacctcatttccttgaactccatttcttctgatatgcaagcagagatatctgaactacttagacctcaagcatcagcagaaatgtatgagtcttttatgtacaaggataatgatgtggatggtgagaacatacagaaggctatttcaggtgatgaagagatatgtggtgccacctcaaaagcgcatgaagcagatgcaattgagggagacttgggaaactacaaccaaccccagctaacatcttctctttcagaggtagaaatcaatctcccaaggaatttggaggtgaatgcagcttcttcagaatctagttaccactttcttctttccaatgaacagacatcagaacaggagaaagacctatcctggttggataaatccatggttgaaccatgtcttgatgatcatttggaagctcttgttattgaagatactgtcaaggaagaggtggacgacataaaggagattgatgcagagttgttatcagaattggatacagttggagatttcagtgtgaaagaagttgttggtgagccactccattatgagttgataacagaggaagctaatgctgtgagcactgaatctgggttgtcgacggcggatccaaacccgttagagtccatccaggagctacctgttcttgagcacactcaggaggtagtagatgttgatgggactttcaaacaaattcatgagggagtcaatgttgaggaggtcatgtgtcctagcgtggttgacaatgagctagaggtagtgtcaaaaagtacagtgcaggccagttcacagttgctaacagttgaagcaacatctttggaagatattattacttcttcaaatcaagctctagacagttctgttaatgagtttccacaactattggatacagaggggtcagcagaattacatctggaattacctccagagggtaatgacgtatcagcagatgtcttgcctgatgcagaggaggagatcgcatcaggcaatataggatccagtgttcaagaaactttcactacgcatattcctttgaagcaactatcagaagttaatgttgctgagctgccaaatccatcaaattcaaaggacgtattgacagaagtaggaactgaggctgtggtggagattgtatcaagcaatgatgtatatggtgttgaagaaactgtcactgattctcctttgaagcaactatcagaaggtaatgttgctgagctgccaaatccatcgaattcaaaggatgtattggcagaagtaggaactgaggctgtggtggagattggatcaagcaatgttgtttatggtgttgaagaaactatcagtgattctcctttgaagcaagtctcggaagatgatgtccgtgggctgccaaaaccatcaaattcaaaggatggatgtgaagaagtaagaactatggtgggggattctatagacgagattggatcgaacaataaaggatctggtgttcaagaaactatccctactcatagtgcgttgaagcaagtctcggaaagtattgtggctgactccatagagattgcatcaggcaatagagaagttgtgcaagaacctatacctactcaagtttcagaaaagaatgttggtgttgaggggtcagcagaattacatctggaattacctccagagggtaatgacgtatcagcagatgtcttgcctgatgcagaggaggagatcgcatcaggcaatataggatccagtgttcaagaaactttcactacgcatattcctttgaagcaactatcagaaggtaatgttgctgagctgccaaatccatcgaattcaaaggatgtattggcagaagtgggaactgaggctgtggtggagattggatcaagcaatgttgtttatggtgttgaagaaactatcagtgattctcctttgaagcaagtctcggaagatgatgtccgtgggctgccaaaaccatcaaattcaaaggatggatgtgaagaagcaagaactatggtgggggattctatagacgagattggatcgaacaataaaggatctggtgttcaagaaactatccctactcatagtgcgttgaagcaagtctcggaaagtattgtggctgactccatagagattgcatcaggcaatagagaagttgtgcaagaacctatacctactcaagtttcagaaaagaatgttggtgttggtgagctgccaaaaccatctgattcaaatgatggattagcagaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

1425

Amino Acids

154.01

Weight (kDa)

4.17

Isoelectric Point (pI)

49.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 72
AccB1I GGYRCC 2 cut(s) 1382, 2225
AccB7I CCANNNNNTGG 1 cut(s) 1024
AccI GTMKAC 4 cut(s) 363, 551, 2031, 2654
AciI CCGC 3 cut(s) 764, 894, 2660
AcoI YGGCCR 1 cut(s) 223
AcuI CTGAAG 4 cut(s) 810, 1339, 1428, 2343
AcyI GRCGYC 1 cut(s) 366
AdeI CACNNNGTG 1 cut(s) 923
AfaI GTAC 3 cut(s) 912, 2159, 2827
AfiI CCNNNNNNNGG 7 cut(s) 617, 920, 1024, 1199, 1675, 2984, 3701
AflIII ACRYGT 1 cut(s) 65
AjiI CACGTC 1 cut(s) 1891
AjnI CCWGG 7 cut(s) 278, 286, 849, 1198, 1668, 2423, 2685
AjuI GAANNNNNNNTTGG 8 cut(s) 1007, 1039, 1316, 1348, 3639, 3671, 4206, 4238
AloI GAACNNNNNNTCC 8 cut(s) 3042, 3074, 3504, 3536, 3759, 3791, 4071, 4103
Alw21I GWGCWC 5 cut(s) 594, 710, 1997, 2639, 2709
Alw26I GTCTC 8 cut(s) 486, 612, 1281, 2259, 3403, 3565, 3970, 4132
Alw44I GTGCAC 1 cut(s) 590
Ama87I CYCGRG 1 cut(s) 612
AoxI GGCC 3 cut(s) 223, 372, 2835
ApaLI GTGCAC 1 cut(s) 590
ArsI GACNNNNNNTTYG 2 cut(s) 1683, 1715
AseI ATTAAT 1 cut(s) 435
Asp700I GAANNNNTTC 1 cut(s) 1645
AspLEI GCGC 3 cut(s) 427, 1149, 2242
AspS9I GGNCC 3 cut(s) 373, 847, 1915
AsuC2I CCSGG 1 cut(s) 688
AvaI CYCGRG 1 cut(s) 612
AvaII GGWCC 2 cut(s) 847, 1915
BaeGI GKGCMC 1 cut(s) 594
BalI TGGCCA 1 cut(s) 225
BamHI GGATCC 3 cut(s) 2662, 3050, 3767
BanI GGYRCC 2 cut(s) 1382, 2225
BanII GRGCYC 1 cut(s) 710
BauI CACGAG 1 cut(s) 1391
BbsI GAAGAC 1 cut(s) 1662
Bbv12I GWGCWC 5 cut(s) 594, 710, 1997, 2639, 2709
BceAI ACGGC 3 cut(s) 353, 1089, 2673
BcgI CGANNNNNNTGC 2 cut(s) 1138, 1172
BciT130I CCWGG 7 cut(s) 280, 288, 851, 1200, 1670, 2425, 2687
BciVI GTATCC 2 cut(s) 2545, 2935
BclI TGATCA 1 cut(s) 2461
BcnI CCSGG 1 cut(s) 688
BcoDI GTCTC 8 cut(s) 486, 612, 1281, 2259, 3403, 3565, 3970, 4132
BfaI CTAG 5 cut(s) 182, 2367, 2787, 2807, 2906
BfmI CTRYAG 3 cut(s) 1539, 3483, 4050
BfuI GTATCC 2 cut(s) 2545, 2935
BlpI GCTNAGC 3 cut(s) 3117, 3267, 3834
Bme1390I CCNGG 8 cut(s) 280, 288, 688, 851, 1200, 1670, 2425, 2687
Bme18I GGWCC 2 cut(s) 847, 1915
BmeT110I CYCGRG 1 cut(s) 612
BmgBI CACGTC 1 cut(s) 1891
BmgT120I GGNCC 3 cut(s) 373, 847, 1915
BmrFI CCNGG 8 cut(s) 280, 288, 688, 851, 1200, 1670, 2425, 2687
BpiI GAAGAC 1 cut(s) 1662
BplI GAGNNNNNCTC 2 cut(s) 326, 358
BpmI CTGGAG 2 cut(s) 2964, 3681
Bpu1102I GCTNAGC 3 cut(s) 3117, 3267, 3834
BpuEI CTTGAG 7 cut(s) 329, 1265, 1988, 2109, 2723, 3621, 4188
BpuMI CCSGG 1 cut(s) 688
BsaBI GATNNNNATC 1 cut(s) 2010
BsaHI GRCGYC 1 cut(s) 366
BsaI GGTCTC 1 cut(s) 1281
BsaXI ACNNNNNCTCC 6 cut(s) 2751, 2765, 2781, 2795, 3217, 3247
Bsc4I CCNNNNNNNGG 7 cut(s) 617, 920, 1024, 1199, 1675, 2984, 3701
Bse118I RCCGGY 2 cut(s) 386, 913
Bse1I ACTGG 4 cut(s) 2027, 2838, 3054, 3771
Bse3DI GCAATG 3 cut(s) 3202, 3352, 3919
Bse8I GATNNNNATC 1 cut(s) 2010
BseBI CCWGG 7 cut(s) 280, 288, 851, 1200, 1670, 2425, 2687
BseJI GATNNNNATC 1 cut(s) 2010
BseLI CCNNNNNNNGG 7 cut(s) 617, 920, 1024, 1199, 1675, 2984, 3701
BseMI GCAATG 3 cut(s) 3202, 3352, 3919
BseNI ACTGG 4 cut(s) 2027, 2838, 3054, 3771
BseSI GKGCMC 1 cut(s) 594
BseYI CCCAGC 1 cut(s) 2289
BsgI GTGCAG 4 cut(s) 113, 172, 467, 2852
BshFI GGCC 3 cut(s) 225, 374, 2837
BshNI GGYRCC 2 cut(s) 1382, 2225
BsiHKAI GWGCWC 5 cut(s) 594, 710, 1997, 2639, 2709
BsiHKCI CYCGRG 1 cut(s) 612
BsiSI CCGG 3 cut(s) 387, 687, 914
BslFI GGGAC 1 cut(s) 2749
BslI CCNNNNNNNGG 7 cut(s) 617, 920, 1024, 1199, 1675, 2984, 3701
BsmAI GTCTC 8 cut(s) 486, 612, 1281, 2259, 3403, 3565, 3970, 4132
BsmFI GGGAC 1 cut(s) 2749
BsmI GAATGC 2 cut(s) 1331, 2353
BsnI GGCC 3 cut(s) 225, 374, 2837
Bso31I GGTCTC 1 cut(s) 1281
BsoBI CYCGRG 1 cut(s) 612
Bsp1286I GDGCHC 5 cut(s) 594, 710, 1997, 2639, 2709
Bsp1407I TGTACA 1 cut(s) 2157
Bsp1720I GCTNAGC 3 cut(s) 3117, 3267, 3834
Bsp19I CCATGG 2 cut(s) 1636, 2439
BspACI CCGC 3 cut(s) 764, 894, 2660
BspANI GGCC 3 cut(s) 225, 374, 2837
BspHI TCATGA 3 cut(s) 658, 1989, 2752
BspT107I GGYRCC 2 cut(s) 1382, 2225
BspTNI GGTCTC 1 cut(s) 1281
BsrDI GCAATG 3 cut(s) 3202, 3352, 3919
BsrFI RCCGGY 2 cut(s) 386, 913
BsrGI TGTACA 1 cut(s) 2157
BsrI ACTGG 4 cut(s) 2027, 2838, 3054, 3771
BssAI RCCGGY 2 cut(s) 386, 913
BssNAI GTATAC 1 cut(s) 552
BssNI GRCGYC 1 cut(s) 366
BssSI CACGAG 1 cut(s) 1391
BssT1I CCWWGG 3 cut(s) 1636, 2330, 2439
Bst1107I GTATAC 1 cut(s) 552
Bst2BI CACGAG 1 cut(s) 1391
Bst2UI CCWGG 7 cut(s) 280, 288, 851, 1200, 1670, 2425, 2687
Bst6I CTCTTC 3 cut(s) 1818, 2208, 2496
BstACI GRCGYC 1 cut(s) 366
BstAPI GCANNNNNTGC 1 cut(s) 1319
BstAUI TGTACA 1 cut(s) 2157
BstC8I GCNNGC 7 cut(s) 349, 388, 518, 792, 1320, 2097, 2835
BstDSI CCRYGG 5 cut(s) 369, 1636, 2439, 3415, 3982
BstHHI GCGC 3 cut(s) 427, 1149, 2242
BstMAI GTCTC 8 cut(s) 486, 612, 1281, 2259, 3403, 3565, 3970, 4132
BstMWI GCNNNNNNNGC 6 cut(s) 728, 763, 1319, 1328, 1396, 2246
BstNI CCWGG 7 cut(s) 280, 288, 851, 1200, 1670, 2425, 2687
BstNSI RCATGY 3 cut(s) 69, 1192, 1322
BstSCI CCNGG 8 cut(s) 278, 286, 686, 849, 1198, 1668, 2423, 2685
BstSFI CTRYAG 3 cut(s) 1539, 3483, 4050
BstSLI GKGCMC 1 cut(s) 594
BstV2I GAAGAC 1 cut(s) 1662
BstX2I RGATCY 6 cut(s) 812, 2662, 3050, 3512, 3767, 4079
BstXI CCANNNNNNTGG 1 cut(s) 1222
BstYI RGATCY 6 cut(s) 812, 2662, 3050, 3512, 3767, 4079
BstZ17I GTATAC 1 cut(s) 552
BsuI GTATCC 2 cut(s) 2545, 2935
BsuRI GGCC 3 cut(s) 225, 374, 2837
BtgI CCRYGG 5 cut(s) 369, 1636, 2439, 3415, 3982
BtgZI GCGATG 2 cut(s) 306, 1299
BtrI CACGTC 1 cut(s) 1891
BtsI GCAGTG 1 cut(s) 189
Cac8I GCNNGC 7 cut(s) 349, 388, 518, 792, 1320, 2097, 2835
CciI TCATGA 3 cut(s) 658, 1989, 2752
CfoI GCGC 3 cut(s) 427, 1149, 2242
Cfr10I RCCGGY 2 cut(s) 386, 913
Cfr13I GGNCC 3 cut(s) 373, 847, 1915
CseI GACGC 2 cut(s) 374, 2060
Csp6I GTAC 3 cut(s) 911, 2158, 2826
CspCI CAANNNNNGTGG 2 cut(s) 2919, 2954
CviQI GTAC 3 cut(s) 911, 2158, 2826
DraIII CACNNNGTG 1 cut(s) 923
EaeI YGGCCR 1 cut(s) 223
Eam1104I CTCTTC 3 cut(s) 1818, 2208, 2496
EarI CTCTTC 3 cut(s) 1818, 2208, 2496
EciI GGCGGA 2 cut(s) 909, 2675
Ecl136II GAGCTC 1 cut(s) 708
Eco130I CCWWGG 3 cut(s) 1636, 2330, 2439
Eco24I GRGCYC 1 cut(s) 710
Eco31I GGTCTC 1 cut(s) 1281
Eco32I GATATC 2 cut(s) 54, 2106
Eco47I GGWCC 2 cut(s) 847, 1915
Eco53kI GAGCTC 1 cut(s) 708
Eco57I CTGAAG 4 cut(s) 810, 1339, 1428, 2343
Eco88I CYCGRG 1 cut(s) 612
EcoICRI GAGCTC 1 cut(s) 708
EcoRI GAATTC 2 cut(s) 3286, 3853
EcoRII CCWGG 7 cut(s) 278, 286, 849, 1198, 1668, 2423, 2685
EcoRV GATATC 2 cut(s) 54, 2106
EcoT14I CCWWGG 3 cut(s) 1636, 2330, 2439
EcoT22I ATGCAT 2 cut(s) 1333, 1621
EcoT38I GRGCYC 1 cut(s) 710
ErhI CCWWGG 3 cut(s) 1636, 2330, 2439
FalI AAGNNNNNCTT 2 cut(s) 1426, 1458
FaqI GGGAC 1 cut(s) 2749
FauI CCCGC 1 cut(s) 771
FbaI TGATCA 1 cut(s) 2461
FblI GTMKAC 4 cut(s) 363, 551, 2031, 2654
FriOI GRGCYC 1 cut(s) 710
FspBI CTAG 5 cut(s) 182, 2367, 2787, 2807, 2906
GlaI GCGC 3 cut(s) 426, 1148, 2241
GsaI CCCAGC 1 cut(s) 2293
GsuI CTGGAG 2 cut(s) 2964, 3681
HaeIII GGCC 3 cut(s) 225, 374, 2837
HapII CCGG 3 cut(s) 387, 687, 914
HgaI GACGC 2 cut(s) 374, 2060
HhaI GCGC 3 cut(s) 427, 1149, 2242
Hin1I GRCGYC 1 cut(s) 366
Hin6I GCGC 3 cut(s) 425, 1147, 2240
HinP1I GCGC 3 cut(s) 425, 1147, 2240
HincII GTYRAC 5 cut(s) 168, 364, 1633, 2655, 2797
HindII GTYRAC 5 cut(s) 168, 364, 1633, 2655, 2797
HindIII AAGCTT 5 cut(s) 1060, 1351, 1372, 1753, 1849
HpaII CCGG 3 cut(s) 387, 687, 914
Hpy99I CGWCG 3 cut(s) 368, 715, 2659
HpyAV CCTTC 8 cut(s) 749, 1041, 1442, 1788, 1891, 2188, 3248, 3815
HpyCH4IV ACGT 5 cut(s) 1659, 1890, 2994, 3147, 3711
HpyF10VI GCNNNNNNNGC 6 cut(s) 728, 763, 1319, 1328, 1396, 2246
HpySE526I ACGT 5 cut(s) 1659, 1890, 2994, 3147, 3711
Hsp92I GRCGYC 1 cut(s) 366
HspAI GCGC 3 cut(s) 425, 1147, 2240
KroI GCCGGC 1 cut(s) 386
KroNI GCCGGC 1 cut(s) 388
Ksp22I TGATCA 1 cut(s) 2461
LmnI GCTCC 6 cut(s) 787, 1003, 1213, 1364, 2023, 2689
MaeI CTAG 5 cut(s) 182, 2367, 2787, 2807, 2906
MaeII ACGT 5 cut(s) 1659, 1890, 2994, 3147, 3711
MaeIII GTNAC 4 cut(s) 1457, 1786, 2369, 3223
MfeI CAATTG 1 cut(s) 2256
MflI RGATCY 6 cut(s) 812, 2662, 3050, 3512, 3767, 4079
MhlI GDGCHC 5 cut(s) 594, 710, 1997, 2639, 2709
MlsI TGGCCA 1 cut(s) 225
MluNI TGGCCA 1 cut(s) 225
MmeI TCCRAC 8 cut(s) 255, 483, 672, 825, 1629, 1740, 2409, 2539
Mox20I TGGCCA 1 cut(s) 225
Mph1103I ATGCAT 2 cut(s) 1333, 1621
MroNI GCCGGC 1 cut(s) 386
MroXI GAANNNNTTC 1 cut(s) 1645
MscI TGGCCA 1 cut(s) 225
MseI TTAA 9 cut(s) 215, 435, 954, 1070, 1119, 1407, 2019, 2919, 3108
MslI CAYNNNNRTG 1 cut(s) 1650
Msp20I TGGCCA 1 cut(s) 225
MspA1I CMGCKG 1 cut(s) 2003
MspI CCGG 3 cut(s) 387, 687, 914
MspR9I CCNGG 8 cut(s) 280, 288, 688, 851, 1200, 1670, 2425, 2687
MunI CAATTG 1 cut(s) 2256
Mva1269I GAATGC 2 cut(s) 1331, 2353
MvaI CCWGG 7 cut(s) 280, 288, 851, 1200, 1670, 2425, 2687
MwoI GCNNNNNNNGC 6 cut(s) 728, 763, 1319, 1328, 1396, 2246
NaeI GCCGGC 1 cut(s) 388
NciI CCSGG 1 cut(s) 688
NcoI CCATGG 2 cut(s) 1636, 2439
NgoMIV GCCGGC 1 cut(s) 386
NmuCI GTSAC 1 cut(s) 3223
NsiI ATGCAT 2 cut(s) 1333, 1621
NspI RCATGY 3 cut(s) 69, 1192, 1322
PaeI GCATGC 1 cut(s) 1322
PagI TCATGA 3 cut(s) 658, 1989, 2752
PciI ACATGT 1 cut(s) 65
PctI GAATGC 2 cut(s) 1331, 2353
PdiI GCCGGC 1 cut(s) 388
PdmI GAANNNNTTC 1 cut(s) 1645
PflMI CCANNNNNTGG 1 cut(s) 1024
PfoI TCCNGGA 1 cut(s) 2685
PscI ACATGT 1 cut(s) 65
PshBI ATTAAT 1 cut(s) 435
PsiI TTATAA 1 cut(s) 72
Psp124BI GAGCTC 1 cut(s) 710
Psp6I CCWGG 7 cut(s) 278, 286, 849, 1198, 1668, 2423, 2685
PspFI CCCAGC 1 cut(s) 2289
PspGI CCWGG 7 cut(s) 278, 286, 849, 1198, 1668, 2423, 2685
PspPI GGNCC 3 cut(s) 373, 847, 1915
PsuI RGATCY 6 cut(s) 812, 2662, 3050, 3512, 3767, 4079
PvuII CAGCTG 1 cut(s) 2003
RsaI GTAC 3 cut(s) 912, 2159, 2827
RsaNI GTAC 3 cut(s) 911, 2158, 2826
RseI CAYNNNNRTG 1 cut(s) 1650
SacI GAGCTC 1 cut(s) 710
SalI GTCGAC 2 cut(s) 362, 2653
SaqAI TTAA 9 cut(s) 215, 435, 954, 1070, 1119, 1407, 2019, 2919, 3108
Sau96I GGNCC 3 cut(s) 373, 847, 1915
ScrFI CCNGG 8 cut(s) 280, 288, 688, 851, 1200, 1670, 2425, 2687
SduI GDGCHC 5 cut(s) 594, 710, 1997, 2639, 2709
SfcI CTRYAG 3 cut(s) 1539, 3483, 4050
SinI GGWCC 2 cut(s) 847, 1915
SmiMI CAYNNNNRTG 1 cut(s) 1650
SmlI CTYRAG 7 cut(s) 308, 1280, 1967, 2124, 2702, 3636, 4203
SmoI CTYRAG 7 cut(s) 308, 1280, 1967, 2124, 2702, 3636, 4203
SphI GCATGC 1 cut(s) 1322
SsiI CCGC 3 cut(s) 764, 894, 2660
SspMI CTAG 5 cut(s) 182, 2367, 2787, 2807, 2906
SstI GAGCTC 1 cut(s) 710
StyD4I CCNGG 8 cut(s) 278, 286, 686, 849, 1198, 1668, 2423, 2685
StyI CCWWGG 3 cut(s) 1636, 2330, 2439
TaiI ACGT 5 cut(s) 1662, 1893, 2997, 3150, 3714
TatI WGTACW 2 cut(s) 2157, 2825
Tru1I TTAA 9 cut(s) 215, 435, 954, 1070, 1119, 1407, 2019, 2919, 3108
Tru9I TTAA 9 cut(s) 215, 435, 954, 1070, 1119, 1407, 2019, 2919, 3108
TseFI GTSAC 1 cut(s) 3223
Tsp45I GTSAC 1 cut(s) 3223
TspGWI ACGGA 4 cut(s) 1328, 1607, 3404, 3971
Van91I CCANNNNNTGG 1 cut(s) 1024
VneI GTGCAC 1 cut(s) 590
VpaK11BI GGWCC 2 cut(s) 847, 1915
VspI ATTAAT 1 cut(s) 435
XbaI TCTAGA 1 cut(s) 2905
XceI RCATGY 3 cut(s) 69, 1192, 1322
XmiI GTMKAC 4 cut(s) 363, 551, 2031, 2654
XmnI GAANNNNTTC 1 cut(s) 1645
XspI CTAG 5 cut(s) 182, 2367, 2787, 2807, 2906
Zsp2I ATGCAT 2 cut(s) 1333, 1621
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.