Rmu_sc0013804.1_g000006

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0013804.1
Physical Location & Seq
Reverse (-)
11938 .. 18163
6226 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0013804.1_g000006.1.cds

Sequence Viewer

Length: 5379 bp
atggggtttatgttagaaattggagttcaaatcaggaaatctgtgaccacatcactcagaacatgttacagatcacttttccatcatccatttctcgtggcatttctgcttttcttgacatttctgcagagattctttccctttgccttttctgttttggtgactgcatcccctgttttggtctgctctgttgttcttcttgggacccttttgattttcggccagccagaattacctgaaaccaaaaggcaaaagaagattacccatgattttgctgctcttagaacccgggtttcagcggatgaggctgtcactttgcagaggaatgggaggttttctatacataagttctcaggaaagagtttagatgaagtgagttgcagtagatacagtagtgatcgtgaaggttcaattggttatgtgcctcttattgatgagacatttcattacgccgagagtgagaagagagaattaaatagtaaggagctggagaaccagagagtcattcataagcagaaattcgggattgatgccatgacaaggaatgtggaagctattgagaagccggcttccctcaaaggtgatcactcggagtcttcacagggtggcggtggtggtgatgatgaggcttcagattctggctcagaccaagcagagagttcatcaccagatgcttcaatagcagacatccttccaattcttgatgagctacacccacttttagacttagatgctccactacctgctcatatgtcccctgatgattctggggttgggtctgataggagtaatgatggcagtaatgagtcagatgatgaggatactgaaatccggggtcgaggagtagaagagtatggggttgatgataatgatggcgatgaggaagaagcacatgatggtaaagaggatgaaagcaaatctgcaatcaagtggacagaggatgaccaaaagaatctcagggacttggggaatttggagcttgaaaggaaccgatgcttggagaaccttattacaaggagaactgcatcgaaaagacagaaccctgagaagaatctgatagatttagatacttctgaaaatccctttaatataacacaaatttcgacaacaagacacaacccttttgatctctcacatgattcctatgatgatatggggttgccacccattcctggttctgctccatctacttacttaccaggaagaaacccctttgatcttctgtatgagccaaatgaagaaaatcctgagctcaagggagatcatgttgagcaagaatttgcaacagttgtccccaataatacattcttttgcaggcatgcaagcattagaccatctaggttaggggatgccaggcaagagaggcacgatcttaaatggagacctgtttttgtaccagaacagttggcttcagaagaaacaagctattgctcattccaaagattaccaagagaagctagtgattccaagttgagttccattcctgatattgagtcagtgagttccggagaagatctggatgaaaggaagttcaatgagcgcgttaaagaagcagaagtgatctccaatatataccaagcttctgagcttgttgaccatagaaggcattcttctgaagatctagatcatctggaaatggaacggcctgggaaaaaagatgtccagcatgatgagccggaaataaaattgggccaggtggagaatgggaatgcaagtttgtctggtacaggaggatttgttattcctgtggaacctattactaatgcaacttatttgaaaccagaagcatttgaagataaaaacagcagtaggtcaagcttgtcatcgtcatcagaagcagatgaaaaatcttcagatttgaggaaagatggatcaaaattttttgagccatttgagacagaagtgcaaactacgagtggaatgctggatgaaaatcaacataaggagccagtctatgacacaagccccccagcatctgcaaaggtcctttcctttaactccatttcttctgatattcaagcagaaatatctgaagtggttacacttccatcattggctgaaatgcgtgttccctccatagaccaagccacagattcagactttcatggtaaaatcagagaagaaggtacttcaggtaatgaacagattggtgccacctcacatgtacgtgcatcagttgaaaatggaagagatcctggggaatgcaaccggctcttcttaacagcttctcattcagatgtaaatgatgatctccctaagaatttgaatgtgaaagcagcttttacagactctagtcctcagtatgtttcttcgaaagataaaatgccagcagaggagaaaaacttattcttgtccgatatgccatcttttcatgatcattttgcatttcctgaaccacgtatcatcttatcagagtcaaaagaagattcaagcatcaaggacttaaatgcagttggagtcccagacccccctgtgggtgtaaaatccacctcaagcaaggtgatagaatcaagcaacgaagcatctgttgttcaacaaactatcagtactcatattgctatggagcaagtctcagaagctaatgagctgccaaagccatcaaattcagaagatgggtcagtggaagtaggaactactgcagtggattctacaaaggagattgcatcaggcaatgcaggaacaagtattcaaggaactgtcacgcctcatgtttctccaaagcaattctcagaagctaatgttggtgagcagacaaattcaaaagataaatcgtcaaaagtggaaactagtacaaagggttccaccaaggagattgcatcaagcaacacagaaactggtgttaaagaacctattgctactcctaattctccgaaggaagtctcaaaaactggtgtcaaagaaccggtcactactcctaattctccaaagaaagtctcagaaaataatgatcctgtgctgcctatttcatcaaaattcaaggatgcgtcaacagaattaggaaccaaaacttctccgaagaaagtctcagaagctaatgatcacgaggtgcctaaaccatcaaattcaaaggatgggtcgacagaatttggaaccaatgcaatgggcactaccaaggagattacatcaattaatataggaactgctgttcaggaaacagttaccactgatcatgctcctaaggaggtttcagaagataatgttggtgagctgccaaaactatcaaatccaaaagatggatctacagacggtggaaataatacagtgggttctaccaaggacattgcactaagcagtacaggatctggtgttcaagaaactgctgaaactcctctgaagcaagtctcagaaagtgatgtcagtaagctgccaaaattatcaaaggacattgcattaagcaatactggatctggtgttcaagaaactgccactactcctgtgaaagaagtctcaaaaactgatgtcagtgagttgccaaaattgtcaaaggatgaactagcaaaagtagcaactaatgatgcagttggttctaccacgagtcttcaagaaactgcccctactcttccgaagcaaatctccaaaggtgatctcagtgagttgccaaaatcatcaaattcaaaggatggatcgaataaaatacaaagtaatgcagtgggttctgccaaggagattgcatcaaatactataggaactggtgttcaagaaactgtctctactcaaactcctgtaaaggaattattagaagttaatgttggagaccagccaaaaccatcagattcaaaagatgaacataaagaaatagaaattaatgcagtgagttttacaaaggagactgcatcaaaaaatgccagatctggtgtaaaagaaacagttactactgaccaaaggaaagtctcagaaggtaatttaattgagctgccaaaaagctcgaattcaaaggatgaatcattggaagtagcaactagtaatgcagtgggttctactaagaatgtaaaagagactgccagtaatcctttggaagaagtttcagaaggtaatgtctttgagctgccaaaaccttcaaactcaaaggatggatcaccaggagtaactaatgcagtgaattctaccaacagtgttaaagatactaacgtcggtgagcttccaaaaccttcaaatgcaaaggatggattgacagaagtaagaactaatgcagtggattctaccaagaagcttgcatcaagcaacacacgaacttgtgtgcaagaaggtaacaccgctcatacttctaaactagtgtcagaaggtgatctctctgagctgccaacagcagaagtaggaactaatgcagtgggttctaccaagaatgttgaagaaactgctactccgaagcaagtttcagaaggtaatatcaacgagctgctaaaaccttcagacttaaaggatggatcaccagaagaaactggtgcagtggattctaccaagagtgttcaagatactaacgtcggtgagctcccaaaaccttcaaatttaaaggatggatcgacagaagtaataactaatgcagttgattctaccaagaagcttgcatcaaccaacatggaaagtaatgtgcaagaaggtatcactgctcatactgctcaacaagtgccagaaggtagtctctctgagctgccgacaccatcacatttaaatgacagatcagcagaagaaggaactaatgcagtgggttctaccaagagtgttgaagaaaccataactactctgaagcaagtttcagaaggtaatatcaacaagctgccaaaacctttagacttaaaggatggatcgaccaaagtgcctaatacagtcagttctaccaagagtgttcaagaaactatcactataaaaaaagtttcagaaggtaatgacggtgagcttcaaaaaccttcaaaggatggatcaacagaagtaggaactaatgtagttgattctaccaagaaacttggaactagtgtacaagaaagtatcactgctcatactgaaaataaaggtgcagaaggtggtgttcgtgagcttcccaaatcatcaaatttaaaggatgaattaccaaaagtaggagttgatgcagtcggttcctccaaggacgttccatcgagcaacacagaatctggtgttcaagaaagtatcactacttcagaaggtgatgttgctgagttgccaagaccatcgaattcggatggtcatgttggtgaggttctaaaaccatctatttcagaagaaagtaatgcgggtgaattgacaaaaccaacaaatccaaaggaaagtaatgcgggtgagtcgcaaacaccaccagatccaaaggaaagtaatgctggtgagtcgcaaaaaacaccagaatcaaaaggatggttatggtggtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

1792

Amino Acids

192.35

Weight (kDa)

4.79

Isoelectric Point (pI)

42.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 751
AccB1I GGYRCC 2 cut(s) 2150, 3046
AccB7I CCANNNNNTGG 1 cut(s) 3233
AccBSI CCGCTC 1 cut(s) 4256
AccI GTMKAC 1 cut(s) 3077
AccII CGCG 1 cut(s) 1542
AccIII TCCGGA 1 cut(s) 1505
AciI CCGC 5 cut(s) 299, 609, 4254, 5246, 5288
AcoI YGGCCR 1 cut(s) 220
AdeI CACNNNGTG 2 cut(s) 605, 3046
AfaI GTAC 8 cut(s) 1395, 1726, 2128, 2166, 2548, 2791, 3295, 4974
AfiI CCNNNNNNNGG 8 cut(s) 178, 540, 997, 1172, 2473, 2474, 3233, 5072
AflIII ACRYGT 2 cut(s) 62, 2161
AgeI ACCGGT 1 cut(s) 2902
AhlI ACTAGT 4 cut(s) 2786, 3959, 4270, 4967
AjnI CCWGG 7 cut(s) 1171, 1198, 1352, 1645, 1692, 2194, 4078
AloI GAACNNNNNNTCC 8 cut(s) 3129, 3161, 3291, 3323, 3396, 3428, 3678, 3710
Alw21I GWGCWC 2 cut(s) 1254, 4491
AlwNI CAGNNNCTG 5 cut(s) 638, 1976, 2834, 3302, 5126
Ama87I CYCGRG 1 cut(s) 288
Aor13HI TCCGGA 1 cut(s) 1505
AoxI GGCC 3 cut(s) 220, 1643, 1690
ArsI GACNNNNNNTTYG 4 cut(s) 2889, 2921, 3059, 3091
AseI ATTAAT 2 cut(s) 3129, 3804
AsiGI ACCGGT 1 cut(s) 2902
Asp700I GAANNNNTTC 1 cut(s) 1606
AspLEI GCGC 1 cut(s) 1542
AspS9I GGNCC 3 cut(s) 204, 1690, 1984
AsuC2I CCSGG 3 cut(s) 289, 290, 833
AsuII TTCGAA 1 cut(s) 2312
AvaI CYCGRG 1 cut(s) 288
AvaII GGWCC 2 cut(s) 204, 1984
AxyI CCTNAGG 1 cut(s) 3177
BaeGI GKGCMC 1 cut(s) 3107
BaeI ACNNNNGTAYC 6 cut(s) 379, 412, 4113, 4146, 4464, 4497
BanI GGYRCC 2 cut(s) 2150, 3046
BanII GRGCYC 2 cut(s) 1254, 4491
BarI GAAGNNNNNNTAC 2 cut(s) 5134, 5166
BauI CACGAG 3 cut(s) 95, 3041, 3532
BbsI GAAGAC 2 cut(s) 588, 3530
Bbv12I GWGCWC 2 cut(s) 1254, 4491
BceAI ACGGC 1 cut(s) 1658
BcgI CGANNNNNNTGC 4 cut(s) 1903, 1937, 4795, 4829
BciT130I CCWGG 7 cut(s) 1173, 1200, 1354, 1647, 1694, 2196, 4080
BciVI GTATCC 1 cut(s) 814
BclI TGATCA 4 cut(s) 583, 2374, 3037, 3166
BcnI CCSGG 3 cut(s) 289, 290, 833
BcuI ACTAGT 4 cut(s) 2786, 3959, 4270, 4967
BfaI CTAG 9 cut(s) 1338, 1458, 1622, 2292, 2787, 3494, 3960, 4271, 4968
BfmI CTRYAG 4 cut(s) 125, 2637, 3240, 3681
BfuAI ACCTGC 1 cut(s) 751
BfuI GTATCC 1 cut(s) 814
BglII AGATCT 3 cut(s) 1513, 1618, 3848
BmcAI AGTACT 1 cut(s) 2548
Bme18I GGWCC 2 cut(s) 204, 1984
BmeT110I CYCGRG 1 cut(s) 288
BmgT120I GGNCC 3 cut(s) 204, 1690, 1984
BoxI GACNNNNGTC 1 cut(s) 2292
BpiI GAAGAC 2 cut(s) 588, 3530
BplI GAGNNNNNCTC 2 cut(s) 2555, 2587
BpmI CTGGAG 1 cut(s) 509
Bpu10I CCTNAGC 1 cut(s) 1248
Bpu14I TTCGAA 1 cut(s) 2312
BpuEI CTTGAG 2 cut(s) 1238, 2476
BpuMI CCSGG 3 cut(s) 289, 290, 833
BsaAI YACGTR 2 cut(s) 2168, 2399
BsaBI GATNNNNATC 2 cut(s) 1623, 1932
BsaI GGTCTC 2 cut(s) 1375, 3747
BsaJI CCNNGG 9 cut(s) 288, 832, 1646, 2195, 2805, 3111, 3273, 3660, 5097
BsaWI WCCGGW 2 cut(s) 1505, 2902
BsaXI ACNNNNNCTCC 8 cut(s) 1251, 1281, 1722, 1752, 3703, 3733, 4345, 4375
Bsc4I CCNNNNNNNGG 8 cut(s) 178, 540, 997, 1172, 2473, 2474, 3233, 5072
Bse118I RCCGGY 3 cut(s) 565, 2208, 2902
Bse1I ACTGG 7 cut(s) 1949, 2839, 2893, 3406, 3694, 4002, 4444
Bse21I CCTNAGG 1 cut(s) 3177
Bse3DI GCAATG 4 cut(s) 2677, 3105, 3279, 3384
Bse8I GATNNNNATC 2 cut(s) 1623, 1932
BseAI TCCGGA 1 cut(s) 1505
BseBI CCWGG 7 cut(s) 1173, 1200, 1354, 1647, 1694, 2196, 4080
BseDI CCNNGG 9 cut(s) 288, 832, 1646, 2195, 2805, 3111, 3273, 3660, 5097
BseJI GATNNNNATC 2 cut(s) 1623, 1932
BseLI CCNNNNNNNGG 8 cut(s) 178, 540, 997, 1172, 2473, 2474, 3233, 5072
BseMI GCAATG 4 cut(s) 2677, 3105, 3279, 3384
BseNI ACTGG 7 cut(s) 1949, 2839, 2893, 3406, 3694, 4002, 4444
BseRI GAGGAG 3 cut(s) 855, 2348, 3318
BseSI GKGCMC 1 cut(s) 3107
BseYI CCCAGC 1 cut(s) 1969
BsgI GTGCAG 2 cut(s) 4464, 5031
Bsh1236I CGCG 1 cut(s) 1542
BshFI GGCC 3 cut(s) 222, 1645, 1692
BshNI GGYRCC 2 cut(s) 2150, 3046
BshTI ACCGGT 1 cut(s) 2902
BsiHKAI GWGCWC 2 cut(s) 1254, 4491
BsiHKCI CYCGRG 1 cut(s) 288
BsiSI CCGG 7 cut(s) 289, 566, 832, 1506, 1676, 2209, 2903
BslFI GGGAC 5 cut(s) 217, 739, 974, 1277, 2444
BslI CCNNNNNNNGG 8 cut(s) 178, 540, 997, 1172, 2473, 2474, 3233, 5072
BsmFI GGGAC 5 cut(s) 217, 739, 974, 1277, 2444
BsmI GAATGC 4 cut(s) 1606, 1714, 1926, 2207
BsnI GGCC 3 cut(s) 222, 1645, 1692
Bso31I GGTCTC 2 cut(s) 1375, 3747
BsoBI CYCGRG 1 cut(s) 288
Bsp119I TTCGAA 1 cut(s) 2312
Bsp1286I GDGCHC 3 cut(s) 1254, 3107, 4491
Bsp13I TCCGGA 1 cut(s) 1505
Bsp1407I TGTACA 1 cut(s) 4972
BspACI CCGC 5 cut(s) 299, 609, 4254, 5246, 5288
BspANI GGCC 3 cut(s) 222, 1645, 1692
BspEI TCCGGA 1 cut(s) 1505
BspFNI CGCG 1 cut(s) 1542
BspHI TCATGA 1 cut(s) 2371
BspMAI CTGCAG 2 cut(s) 129, 2641
BspMI ACCTGC 1 cut(s) 751
BspQI GCTCTTC 1 cut(s) 2219
BspT104I TTCGAA 1 cut(s) 2312
BspT107I GGYRCC 2 cut(s) 2150, 3046
BspTNI GGTCTC 2 cut(s) 1375, 3747
BsrBI CCGCTC 1 cut(s) 4256
BsrDI GCAATG 4 cut(s) 2677, 3105, 3279, 3384
BsrFI RCCGGY 3 cut(s) 565, 2208, 2902
BsrGI TGTACA 1 cut(s) 4972
BsrI ACTGG 7 cut(s) 1949, 2839, 2893, 3406, 3694, 4002, 4444
BssAI RCCGGY 3 cut(s) 565, 2208, 2902
BssECI CCNNGG 9 cut(s) 288, 832, 1646, 2195, 2805, 3111, 3273, 3660, 5097
BssSI CACGAG 3 cut(s) 95, 3041, 3532
BssT1I CCWWGG 5 cut(s) 2805, 3111, 3273, 3660, 5097
Bst2BI CACGAG 3 cut(s) 95, 3041, 3532
Bst2UI CCWGG 7 cut(s) 1173, 1200, 1354, 1647, 1694, 2196, 4080
Bst6I CTCTTC 5 cut(s) 458, 843, 2182, 2219, 3564
BstAUI TGTACA 1 cut(s) 4972
BstBAI YACGTR 2 cut(s) 2168, 2399
BstBI TTCGAA 1 cut(s) 2312
BstC8I GCNNGC 8 cut(s) 224, 567, 1316, 1320, 1324, 2328, 4212, 4563
BstFNI CGCG 1 cut(s) 1542
BstHHI GCGC 1 cut(s) 1542
BstMWI GCNNNNNNNGC 7 cut(s) 305, 680, 1363, 1672, 2593, 3503, 4613
BstNI CCWGG 7 cut(s) 1173, 1200, 1354, 1647, 1694, 2196, 4080
BstNSI RCATGY 3 cut(s) 66, 1322, 2165
BstPAI GACNNNNGTC 1 cut(s) 2292
BstSFI CTRYAG 4 cut(s) 125, 2637, 3240, 3681
BstSLI GKGCMC 1 cut(s) 3107
BstUI CGCG 1 cut(s) 1542
BstV2I GAAGAC 2 cut(s) 588, 3530
BstX2I RGATCY 8 cut(s) 1513, 1618, 2191, 3236, 3299, 3404, 3848, 5311
BstXI CCANNNNNNTGG 1 cut(s) 3100
BstYI RGATCY 8 cut(s) 1513, 1618, 2191, 3236, 3299, 3404, 3848, 5311
Bsu36I CCTNAGG 1 cut(s) 3177
BsuI GTATCC 1 cut(s) 814
BsuRI GGCC 3 cut(s) 222, 1645, 1692
BtgZI GCGATG 1 cut(s) 891
BveI ACCTGC 1 cut(s) 751
Cac8I GCNNGC 8 cut(s) 224, 567, 1316, 1320, 1324, 2328, 4212, 4563
CaiI CAGNNNCTG 5 cut(s) 638, 1976, 2834, 3302, 5126
CciI TCATGA 1 cut(s) 2371
CfoI GCGC 1 cut(s) 1542
Cfr10I RCCGGY 3 cut(s) 565, 2208, 2902
Cfr13I GGNCC 3 cut(s) 204, 1690, 1984
Cfr9I CCCGGG 1 cut(s) 288
CseI GACGC 1 cut(s) 2973
Csp6I GTAC 8 cut(s) 1394, 1725, 2127, 2165, 2547, 2790, 3294, 4973
CspAI ACCGGT 1 cut(s) 2902
CspCI CAANNNNNGTGG 2 cut(s) 528, 563
CviQI GTAC 8 cut(s) 1394, 1725, 2127, 2165, 2547, 2790, 3294, 4973
DraI TTTAAA 3 cut(s) 4509, 4668, 5052
DraIII CACNNNGTG 2 cut(s) 605, 3046
EaeI YGGCCR 1 cut(s) 220
Eam1104I CTCTTC 5 cut(s) 458, 843, 2182, 2219, 3564
EarI CTCTTC 5 cut(s) 458, 843, 2182, 2219, 3564
Ecl136II GAGCTC 2 cut(s) 1252, 4489
Eco130I CCWWGG 5 cut(s) 2805, 3111, 3273, 3660, 5097
Eco24I GRGCYC 2 cut(s) 1254, 4491
Eco31I GGTCTC 2 cut(s) 1375, 3747
Eco47I GGWCC 2 cut(s) 204, 1984
Eco53kI GAGCTC 2 cut(s) 1252, 4489
Eco81I CCTNAGG 1 cut(s) 3177
Eco88I CYCGRG 1 cut(s) 288
EcoICRI GAGCTC 2 cut(s) 1252, 4489
EcoO109I RGGNCCY 2 cut(s) 204, 1984
EcoRI GAATTC 3 cut(s) 3928, 4099, 5188
EcoRII CCWGG 7 cut(s) 1171, 1198, 1352, 1645, 1692, 2194, 4078
EcoT14I CCWWGG 5 cut(s) 2805, 3111, 3273, 3660, 5097
EcoT38I GRGCYC 2 cut(s) 1254, 4491
ErhI CCWWGG 5 cut(s) 2805, 3111, 3273, 3660, 5097
FalI AAGNNNNNCTT 2 cut(s) 1594, 1626
FaqI GGGAC 5 cut(s) 217, 739, 974, 1277, 2444
FauI CCCGC 2 cut(s) 5239, 5281
FauNDI CATATG 1 cut(s) 750
FbaI TGATCA 4 cut(s) 583, 2374, 3037, 3166
FblI GTMKAC 1 cut(s) 3077
FriOI GRGCYC 2 cut(s) 1254, 4491
FspBI CTAG 9 cut(s) 1338, 1458, 1622, 2292, 2787, 3494, 3960, 4271, 4968
GlaI GCGC 1 cut(s) 1541
GsaI CCCAGC 1 cut(s) 1973
GsuI CTGGAG 1 cut(s) 509
HaeIII GGCC 3 cut(s) 222, 1645, 1692
HapII CCGG 7 cut(s) 289, 566, 832, 1506, 1676, 2209, 2903
HgaI GACGC 1 cut(s) 2973
HhaI GCGC 1 cut(s) 1542
Hin6I GCGC 1 cut(s) 1540
HinP1I GCGC 1 cut(s) 1540
HincII GTYRAC 3 cut(s) 1594, 2988, 3078
HindII GTYRAC 3 cut(s) 1594, 2988, 3078
HindIII AAGCTT 4 cut(s) 1578, 1816, 4208, 4559
HpaII CCGG 7 cut(s) 289, 566, 832, 1506, 1676, 2209, 2903
Hpy166II GTNNAC 5 cut(s) 933, 1594, 2988, 3078, 4973
Hpy8I GTNNAC 5 cut(s) 933, 1594, 2988, 3078, 4973
Hpy99I CGWCG 2 cut(s) 4133, 4484
HpyCH4IV ACGT 5 cut(s) 2167, 2398, 4128, 4479, 5103
HpyF10VI GCNNNNNNNGC 7 cut(s) 305, 680, 1363, 1672, 2593, 3503, 4613
HpySE526I ACGT 5 cut(s) 2167, 2398, 4128, 4479, 5103
HspAI GCGC 1 cut(s) 1540
KflI GGGWCCC 1 cut(s) 204
Kpn2I TCCGGA 1 cut(s) 1505
KroI GCCGGC 1 cut(s) 565
KroNI GCCGGC 1 cut(s) 567
Ksp22I TGATCA 4 cut(s) 583, 2374, 3037, 3166
LguI GCTCTTC 1 cut(s) 2219
LmnI GCTCC 8 cut(s) 484, 739, 976, 1186, 1945, 2563, 3178, 4494
MaeI CTAG 9 cut(s) 1338, 1458, 1622, 2292, 2787, 3494, 3960, 4271, 4968
MaeII ACGT 5 cut(s) 2167, 2398, 4128, 4479, 5103
MbiI CCGCTC 1 cut(s) 4256
MfeI CAATTG 1 cut(s) 411
MflI RGATCY 8 cut(s) 1513, 1618, 2191, 3236, 3299, 3404, 3848, 5311
MhlI GDGCHC 3 cut(s) 1254, 3107, 4491
MmeI TCCRAC 2 cut(s) 2434, 3730
MroI TCCGGA 1 cut(s) 1505
MroNI GCCGGC 1 cut(s) 565
MroXI GAANNNNTTC 1 cut(s) 1606
MslI CAYNNNNRTG 4 cut(s) 2166, 2235, 4668, 5205
MspA1I CMGCKG 1 cut(s) 299
MspI CCGG 7 cut(s) 289, 566, 832, 1506, 1676, 2209, 2903
MunI CAATTG 1 cut(s) 411
Mva1269I GAATGC 4 cut(s) 1606, 1714, 1926, 2207
MvaI CCWGG 7 cut(s) 1173, 1200, 1354, 1647, 1694, 2196, 4080
MvnI CGCG 1 cut(s) 1542
MwoI GCNNNNNNNGC 7 cut(s) 305, 680, 1363, 1672, 2593, 3503, 4613
NaeI GCCGGC 1 cut(s) 567
NciI CCSGG 3 cut(s) 289, 290, 833
NdeI CATATG 1 cut(s) 750
NgoMIV GCCGGC 1 cut(s) 565
NmeAIII GCCGAG 1 cut(s) 478
NmuCI GTSAC 5 cut(s) 43, 160, 310, 2698, 2905
NspI RCATGY 3 cut(s) 66, 1322, 2165
NspV TTCGAA 1 cut(s) 2312
PaeI GCATGC 1 cut(s) 1322
PagI TCATGA 1 cut(s) 2371
PciI ACATGT 2 cut(s) 62, 2161
PciSI GCTCTTC 1 cut(s) 2219
PctI GAATGC 4 cut(s) 1606, 1714, 1926, 2207
PdiI GCCGGC 1 cut(s) 567
PdmI GAANNNNTTC 1 cut(s) 1606
PflMI CCANNNNNTGG 1 cut(s) 3233
PinAI ACCGGT 1 cut(s) 2902
Ppu21I YACGTR 2 cut(s) 2168, 2399
PpuMI RGGWCCY 2 cut(s) 204, 1984
PscI ACATGT 2 cut(s) 62, 2161
PshAI GACNNNNGTC 1 cut(s) 2292
PshBI ATTAAT 2 cut(s) 3129, 3804
Psp124BI GAGCTC 2 cut(s) 1254, 4491
Psp5II RGGWCCY 2 cut(s) 204, 1984
Psp6I CCWGG 7 cut(s) 1171, 1198, 1352, 1645, 1692, 2194, 4078
PspFI CCCAGC 1 cut(s) 1969
PspGI CCWGG 7 cut(s) 1171, 1198, 1352, 1645, 1692, 2194, 4078
PspPI GGNCC 3 cut(s) 204, 1690, 1984
PspPPI RGGWCCY 2 cut(s) 204, 1984
PsrI GAACNNNNNNTAC 2 cut(s) 2782, 2814
PstI CTGCAG 2 cut(s) 129, 2641
PstNI CAGNNNCTG 5 cut(s) 638, 1976, 2834, 3302, 5126
PsuI RGATCY 8 cut(s) 1513, 1618, 2191, 3236, 3299, 3404, 3848, 5311
RsaI GTAC 8 cut(s) 1395, 1726, 2128, 2166, 2548, 2791, 3295, 4974
RsaNI GTAC 8 cut(s) 1394, 1725, 2127, 2165, 2547, 2790, 3294, 4973
RseI CAYNNNNRTG 4 cut(s) 2166, 2235, 4668, 5205
SacI GAGCTC 2 cut(s) 1254, 4491
SalI GTCGAC 1 cut(s) 3076
SapI GCTCTTC 1 cut(s) 2219
Sau96I GGNCC 3 cut(s) 204, 1690, 1984
ScaI AGTACT 1 cut(s) 2548
SduI GDGCHC 3 cut(s) 1254, 3107, 4491
SfcI CTRYAG 4 cut(s) 125, 2637, 3240, 3681
SfuI TTCGAA 1 cut(s) 2312
SinI GGWCC 2 cut(s) 204, 1984
SmaI CCCGGG 1 cut(s) 290
SmiI ATTTAAAT 1 cut(s) 4668
SmiMI CAYNNNNRTG 4 cut(s) 2166, 2235, 4668, 5205
SmlI CTYRAG 2 cut(s) 1253, 2491
SmoI CTYRAG 2 cut(s) 1253, 2491
SpeI ACTAGT 4 cut(s) 2786, 3959, 4270, 4967
SphI GCATGC 1 cut(s) 1322
SsiI CCGC 5 cut(s) 299, 609, 4254, 5246, 5288
SspMI CTAG 9 cut(s) 1338, 1458, 1622, 2292, 2787, 3494, 3960, 4271, 4968
SstI GAGCTC 2 cut(s) 1254, 4491
StyI CCWWGG 5 cut(s) 2805, 3111, 3273, 3660, 5097
SwaI ATTTAAAT 1 cut(s) 4668
TaiI ACGT 5 cut(s) 2170, 2401, 4131, 4482, 5106
TatI WGTACW 4 cut(s) 2546, 2789, 3293, 4972
TseFI GTSAC 5 cut(s) 43, 160, 310, 2698, 2905
Tsp45I GTSAC 5 cut(s) 43, 160, 310, 2698, 2905
TspMI CCCGGG 1 cut(s) 288
Van91I CCANNNNNTGG 1 cut(s) 3233
VpaK11BI GGWCC 2 cut(s) 204, 1984
VspI ATTAAT 2 cut(s) 3129, 3804
XbaI TCTAGA 1 cut(s) 1621
XceI RCATGY 3 cut(s) 66, 1322, 2165
XcmI CCANNNNNNNNNTGG 2 cut(s) 1700, 4009
XmaI CCCGGG 1 cut(s) 288
XmiI GTMKAC 1 cut(s) 3077
XmnI GAANNNNTTC 1 cut(s) 1606
XspI CTAG 9 cut(s) 1338, 1458, 1622, 2292, 2787, 3494, 3960, 4271, 4968
ZrmI AGTACT 1 cut(s) 2548
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.