Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0006163.1

Orthogroup ID

OG0002241

Physical Location & Seq

Genomic Coordinates Reverse (-)

76867 .. 79577

Gene Structure 2711 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0006163.1_g000016.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 2711 bp

aagagtttattgcatcgcatgccaacgatgcattcttccgtaggcatgaaagcttcagtttgggagcttcaagcttgggggttgccaagcacgagaggcaagaatttaagtggaaacctgttttcgtaccagaaagattggcttcagaaggaacaggttactcctcatttcaaagacaatcaagtgaagttagtgaatcaaagttgagttctgttcctgatagcgactcggtgagttctgtagcagatttggatgataggaagttcagtgagcaagactttactaaagaaacggaagttatctccaacatttatcatgcatctggtcttgttgaccatggaagtcattcctatgaagacgtatattccctggaaatggaacaggctgacaaaagggatgtccaacacaatgggcttgatatagaattgggtaaaagggaaaatctagaaccaagcttgtcggataatggaggcgtacctactgttgttactaatgaactccatctgaatccagaattagttgaagaggaggacagcagcagtaggtcaagcttgtcatcattgtcagaagcagatgaaaaattttcagatgtgaggaagggtgaaaaaagtttggacccaagtggtgatctcaacaaggagtttctaatttcaccgcaacattcacttgaggagtcaaatgttcaattcatgagcacggcagctgatgaaaatcaatttaaggagccagtctacgactcaactccccttgacgcagaaaacctcatttccttgaactccatttcttctgatatgcaagcagagatatctgaactagttagacctcaagcatcagcggaaatgtatgagtcttttatgtacaaagataatgatgtggatggtgagaacatagagaaggctatttcaggtgatgaagagatatgtggtgccacctcaaaagcgcatgaagcagatgcaattgagggagacttgggaaactacaaccaaccccagctaacatcttctctttcagaggtagaaatcaatctcccaaggaatttggaggtgaatgcagcttcttcagaatctagttaccactttcttctttccaatgaacagacatcagaacaggagaaaaatctatcctggttggataaatccatggttgaaccatgtcttgatgatcatttggaagctcttgttattgaagatactgtcagggaagaggtggacgacataaaggagattgatgcagagttgttatcagaattggatacagttggagatttcagtgtgaaagaagttgttggtgagccactccattatgagttgataacagaggaagctaatgctgtgagcactgaatctgggttgtcgacggcggatccaaacccgttagagtccatccaggagctacctgttcttgagcacactcaggaggtagtagatgttgatgggactttcaaacaaattcatgagggagtcaatgttgaggaggtcatgtgtcctagcgtggtagacaatgagctagaggtagtgtcaaaaagtacagtgcaggccagttcacagttgctaacagttgaagcaacatctttggaagatattattacttcttcaaatcaagctctagacagttctgttaatgagtttccacaactattggatacagaggggtcagcaggattacatctggaattacctccagagggtaatgacgtatcagcagatgtcttgcctgatgcagaggaggagatcgcatcaggcaatataggatccagtattcaagaaactttcactacgcatattcctttgaagcaactatcagaaggtaatgttgctgagctgccaaatccatcaaattcaaaggacgtattggcagaagtaggaactgaggctgtggcggagattgtatcaagcaatgttgtatatggtgttgaagaaactgtcactgattctcctttgaagcaactatcagaaggtaatgttgctgagctgccaaatccatcaaattcaaaggacgtattggcagaagtaggaactgaggctgtggcggagattgtatcaagcaatgttgtatatggtgttgaagaaactgtcactgattctcctttgaagcaactatcagaaggtaatgttgctgagctgccaaatccatcaaattcaaaggacgtattggcagaagtaggaactgaggctgtggcggagattgtatcaagcaatgatgtatatggtgttgaagaaactatcactgattctcctttgaagcaactatcagaaggtaatgttgctgagctgccaaatccatcgaattcaaaggatgtattggcagaagtaggaactgaggctgtggtggagattggatcaagcaatgttgtttatggtgttgaagaaactatcagtgattctcctttgaagcaagtctcggaagatgatgtccgtgggctgccaaaaccatcaaattcaaaggatggatgtgaagaagcaagaactatggtgggggattctatagacgagattggatcgaacaataaaggatctggtgttcaagaaactatccctactcatagtgcgttgaagcaagtctcggaaagtattgtggctgactccatagagattgcatcaggcaatagagaagttgtgcaagaacctatacctactcaagtttcagaaaagaatgttggtgttggtgagctgccaaaaccatctgattcaaatgatggattagcagaatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

902

Amino Acids

97.19

Weight (kDa)

4.1

Isoelectric Point (pI)

48.14

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002241)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G17910 AT5G17910 AT5G17910
fragaria_vesca	FvH4_1g29420 FvH4_1g29420 FvH4_1g29420 FvH4_2g10091 FvH4_2g10092
malus_domestica	MD05G1057800.v1.1 MD12G1015000.v1.1 MD14G1012900.v1.1
prunus_persica	Prupe.7G025700_v2.0.a1 Prupe.7G025700_v2.0.a1 Prupe.7G025700_v2.0.a1 Prupe.8G087600_v2.0.a1 Prupe.8G087600_v2.0.a1 Prupe.8G087600_v2.0.a1
pyrus_communis	pycom05g04890 pycom12g01220 pycom14g01090
rosa_chinensis	RchiOBHm_Chr3g0495491 RchiOBHm_Chr6g0267051
rosa_laevigata	RLG00000014046 RLG00000022616
rosa_multiflora	Rmu_co8285861.1_g000001 Rmu_sc0004755.1_g000026 Rmu_sc0005599.1_g000001 Rmu_sc0006163.1_g000016 Rmu_sc0013804.1_g000006
rosa_roxburghii	Rroxscaffold_6G00390490 Rroxscaffold_7G00201200
rosa_rugosa	Rorug03G0273800 Rorug06G0028700
rosa_samantha	Rh3AG321400 Rh3BG356700 Rh3CG353500 Rh3DG356000 Rh6AG150200 Rh6BG151100 Rh6CG146500 Rh6DG135200
rosa_wichuraiana	Rw3G028090 Rw6G013020

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	925
AccI	GTMKAC	3 cut(s)	731, 1354, 1496
AciI	CCGC	6 cut(s)	655, 835, 1360, 1879, 2029, 2179
AclWI	GGATC	7 cut(s)	1357, 1370, 1745, 1758, 2346, 2505, 2520
AcsI	RAATTY	9 cut(s)	103, 580, 1035, 1448, 1836, 1986, 2136, 2286, 2436
AcuI	CTGAAG	3 cut(s)	39, 128, 1043
AfaI	GTAC	4 cut(s)	128, 476, 859, 1527
AfiI	CCNNNNNNNGG	2 cut(s)	375, 1684
AhlI	ACTAGT	1 cut(s)	813
AjnI	CCWGG	3 cut(s)	368, 1123, 1385
AjuI	GAANNNNNNNTTGG	4 cut(s)	16, 48, 2639, 2671
AloI	GAACNNNNNNTCC	2 cut(s)	2504, 2536
Alw21I	GWGCWC	3 cut(s)	697, 1339, 1409
Alw26I	GTCTC	3 cut(s)	959, 2403, 2565
AlwI	GGATC	7 cut(s)	1357, 1370, 1745, 1758, 2346, 2505, 2520
AoxI	GGCC	1 cut(s)	1535
ApeKI	GCWGC	9 cut(s)	536, 700, 1051, 1821, 1971, 2121, 2271, 2421, 2670
ApoI	RAATTY	9 cut(s)	103, 580, 1035, 1448, 1836, 1986, 2136, 2286, 2436
ArsI	GACNNNNNNTTYG	2 cut(s)	383, 415
Asp700I	GAANNNNTTC	1 cut(s)	345
AspLEI	GCGC	1 cut(s)	942
AspS9I	GGNCC	1 cut(s)	615
AsuHPI	GGTGA	9 cut(s)	243, 613, 637, 644, 892, 919, 1056, 1300, 2677
AvaII	GGWCC	1 cut(s)	615
BamHI	GGATCC	2 cut(s)	1362, 1750
BanI	GGYRCC	1 cut(s)	925
BauI	CACGAG	1 cut(s)	91
BbsI	GAAGAC	1 cut(s)	362
Bbv12I	GWGCWC	3 cut(s)	697, 1339, 1409
BbvI	GCAGC	9 cut(s)	548, 712, 1063, 1808, 1958, 2108, 2258, 2408, 2657
BceAI	ACGGC	2 cut(s)	713, 1373
BciT130I	CCWGG	3 cut(s)	370, 1125, 1387
BciVI	GTATCC	2 cut(s)	1245, 1635
BclI	TGATCA	1 cut(s)	1161
BcoDI	GTCTC	3 cut(s)	959, 2403, 2565
BcuI	ACTAGT	1 cut(s)	813
BfaI	CTAG	6 cut(s)	445, 814, 1067, 1487, 1507, 1606
BfmI	CTRYAG	2 cut(s)	239, 2483
BfuI	GTATCC	2 cut(s)	1245, 1635
BisI	GCNGC	9 cut(s)	537, 701, 1052, 1822, 1972, 2122, 2272, 2422, 2671
BlpI	GCTNAGC	4 cut(s)	1817, 1967, 2117, 2267
BlsI	GCNGC	9 cut(s)	538, 702, 1053, 1823, 1973, 2123, 2273, 2423, 2672
Bme1390I	CCNGG	3 cut(s)	370, 1125, 1387
Bme18I	GGWCC	1 cut(s)	615
BmgT120I	GGNCC	1 cut(s)	615
BmiI	GGNNCC	5 cut(s)	617, 725, 927, 1364, 1752
BmrFI	CCNGG	3 cut(s)	370, 1125, 1387
BmsI	GCATC	9 cut(s)	18, 22, 328, 838, 942, 1218, 1707, 1744, 2605
BpiI	GAAGAC	1 cut(s)	362
BpmI	CTGGAG	1 cut(s)	1664
Bpu1102I	GCTNAGC	4 cut(s)	1817, 1967, 2117, 2267
BpuEI	CTTGAG	4 cut(s)	688, 809, 1423, 2621
BsaBI	GATNNNNATC	1 cut(s)	710
BsaJI	CCNNGG	5 cut(s)	336, 368, 1030, 1139, 2415
Bsc4I	CCNNNNNNNGG	2 cut(s)	375, 1684
Bse1I	ACTGG	3 cut(s)	727, 1538, 1754
Bse3DI	GCAATG	4 cut(s)	1902, 2052, 2202, 2352
Bse8I	GATNNNNATC	1 cut(s)	710
BseBI	CCWGG	3 cut(s)	370, 1125, 1387
BseDI	CCNNGG	5 cut(s)	336, 368, 1030, 1139, 2415
BseGI	GGATG	7 cut(s)	258, 402, 882, 1382, 2301, 2451, 2455
BseJI	GATNNNNATC	1 cut(s)	710
BseLI	CCNNNNNNNGG	2 cut(s)	375, 1684
BseMI	GCAATG	4 cut(s)	1902, 2052, 2202, 2352
BseMII	CTCAG	9 cut(s)	1426, 1808, 1859, 1958, 2009, 2108, 2159, 2258, 2309
BseNI	ACTGG	3 cut(s)	727, 1538, 1754
BseRI	GAGGAG	6 cut(s)	153, 541, 685, 1486, 1738, 1741
BseXI	GCAGC	9 cut(s)	548, 712, 1063, 1808, 1958, 2108, 2258, 2408, 2657
BseYI	CCCAGC	1 cut(s)	989
BsgI	GTGCAG	1 cut(s)	1552
BshFI	GGCC	1 cut(s)	1537
BshNI	GGYRCC	1 cut(s)	925
BsiHKAI	GWGCWC	3 cut(s)	697, 1339, 1409
BslFI	GGGAC	1 cut(s)	1449
BslI	CCNNNNNNNGG	2 cut(s)	375, 1684
BsmAI	GTCTC	3 cut(s)	959, 2403, 2565
BsmFI	GGGAC	1 cut(s)	1449
BsmI	GAATGC	2 cut(s)	31, 1053
BsnI	GGCC	1 cut(s)	1537
Bsp1286I	GDGCHC	3 cut(s)	697, 1339, 1409
Bsp1407I	TGTACA	1 cut(s)	857
Bsp143I	GATC	8 cut(s)	627, 1161, 1362, 1730, 1750, 2338, 2497, 2512
Bsp1720I	GCTNAGC	4 cut(s)	1817, 1967, 2117, 2267
Bsp19I	CCATGG	2 cut(s)	336, 1139
BspACI	CCGC	6 cut(s)	655, 835, 1360, 1879, 2029, 2179
BspANI	GGCC	1 cut(s)	1537
BspCNI	CTCAG	9 cut(s)	1425, 1809, 1860, 1959, 2010, 2109, 2160, 2259, 2310
BspHI	TCATGA	2 cut(s)	689, 1452
BspLI	GGNNCC	5 cut(s)	617, 725, 927, 1364, 1752
BspPI	GGATC	7 cut(s)	1357, 1370, 1745, 1758, 2346, 2505, 2520
BspT107I	GGYRCC	1 cut(s)	925
BsrDI	GCAATG	4 cut(s)	1902, 2052, 2202, 2352
BsrGI	TGTACA	1 cut(s)	857
BsrI	ACTGG	3 cut(s)	727, 1538, 1754
BssECI	CCNNGG	5 cut(s)	336, 368, 1030, 1139, 2415
BssMI	GATC	8 cut(s)	627, 1161, 1362, 1730, 1750, 2338, 2497, 2512
BssSI	CACGAG	1 cut(s)	91
BssT1I	CCWWGG	3 cut(s)	336, 1030, 1139
Bst2BI	CACGAG	1 cut(s)	91
Bst2UI	CCWGG	3 cut(s)	370, 1125, 1387
Bst4CI	ACNGT	9 cut(s)	483, 1194, 1257, 1530, 1547, 1557, 1612, 1923, 2073
Bst6I	CTCTTC	3 cut(s)	518, 908, 1196
BstAPI	GCANNNNNTGC	1 cut(s)	19
BstAUI	TGTACA	1 cut(s)	857
BstC8I	GCNNGC	3 cut(s)	20, 797, 1535
BstDEI	CTNAG	9 cut(s)	1412, 1817, 1868, 1967, 2018, 2117, 2168, 2267, 2318
BstDSI	CCRYGG	3 cut(s)	336, 1139, 2415
BstF5I	GGATG	7 cut(s)	258, 402, 882, 1382, 2301, 2451, 2455
BstHHI	GCGC	1 cut(s)	942
BstKTI	GATC	8 cut(s)	630, 1164, 1365, 1733, 1753, 2341, 2500, 2515
BstMAI	GTCTC	3 cut(s)	959, 2403, 2565
BstMBI	GATC	8 cut(s)	627, 1161, 1362, 1730, 1750, 2338, 2497, 2512
BstMWI	GCNNNNNNNGC	4 cut(s)	19, 28, 96, 946
BstNI	CCWGG	3 cut(s)	370, 1125, 1387
BstNSI	RCATGY	1 cut(s)	22
BstSCI	CCNGG	3 cut(s)	368, 1123, 1385
BstSFI	CTRYAG	2 cut(s)	239, 2483
BstV1I	GCAGC	9 cut(s)	548, 712, 1063, 1808, 1958, 2108, 2258, 2408, 2657
BstV2I	GAAGAC	1 cut(s)	362
BstX2I	RGATCY	3 cut(s)	1362, 1750, 2512
BstXI	CCANNNNNNTGG	1 cut(s)	409
BstYI	RGATCY	3 cut(s)	1362, 1750, 2512
BsuI	GTATCC	2 cut(s)	1245, 1635
BsuRI	GGCC	1 cut(s)	1537
BtgI	CCRYGG	3 cut(s)	336, 1139, 2415
BtsCI	GGATG	7 cut(s)	258, 402, 882, 1382, 2301, 2451, 2455
BtsIMutI	CAGTG	8 cut(s)	273, 1275, 1337, 1535, 1925, 2075, 2225, 2382
Cac8I	GCNNGC	3 cut(s)	20, 797, 1535
CciI	TCATGA	2 cut(s)	689, 1452
CfoI	GCGC	1 cut(s)	942
Cfr13I	GGNCC	1 cut(s)	615
CseI	GACGC	1 cut(s)	760
Csp6I	GTAC	4 cut(s)	127, 475, 858, 1526
CspCI	CAANNNNNGTGG	2 cut(s)	1619, 1654
CviQI	GTAC	4 cut(s)	127, 475, 858, 1526
DdeI	CTNAG	9 cut(s)	1412, 1817, 1868, 1967, 2018, 2117, 2168, 2267, 2318
DpnI	GATC	8 cut(s)	629, 1163, 1364, 1732, 1752, 2340, 2499, 2514
DpnII	GATC	8 cut(s)	627, 1161, 1362, 1730, 1750, 2338, 2497, 2512
Eam1104I	CTCTTC	3 cut(s)	518, 908, 1196
EarI	CTCTTC	3 cut(s)	518, 908, 1196
EciI	GGCGGA	4 cut(s)	1375, 1894, 2044, 2194
Eco130I	CCWWGG	3 cut(s)	336, 1030, 1139
Eco32I	GATATC	1 cut(s)	806
Eco47I	GGWCC	1 cut(s)	615
Eco57I	CTGAAG	3 cut(s)	39, 128, 1043
EcoRI	GAATTC	1 cut(s)	2286
EcoRII	CCWGG	3 cut(s)	368, 1123, 1385
EcoRV	GATATC	1 cut(s)	806
EcoT14I	CCWWGG	3 cut(s)	336, 1030, 1139
EcoT22I	ATGCAT	2 cut(s)	33, 321
ErhI	CCWWGG	3 cut(s)	336, 1030, 1139
FalI	AAGNNNNNCTT	2 cut(s)	126, 158
FaqI	GGGAC	1 cut(s)	1449
FbaI	TGATCA	1 cut(s)	1161
FblI	GTMKAC	3 cut(s)	731, 1354, 1496
Fnu4HI	GCNGC	9 cut(s)	537, 701, 1052, 1822, 1972, 2122, 2272, 2422, 2671
FokI	GGATG	7 cut(s)	265, 409, 889, 1369, 2308, 2458, 2462
Fsp4HI	GCNGC	9 cut(s)	537, 701, 1052, 1822, 1972, 2122, 2272, 2422, 2671
FspBI	CTAG	6 cut(s)	445, 814, 1067, 1487, 1507, 1606
GlaI	GCGC	1 cut(s)	941
GluI	GCNGC	9 cut(s)	537, 701, 1052, 1822, 1972, 2122, 2272, 2422, 2671
GsaI	CCCAGC	1 cut(s)	993
GsuI	CTGGAG	1 cut(s)	1664
HaeIII	GGCC	1 cut(s)	1537
HgaI	GACGC	1 cut(s)	760
HhaI	GCGC	1 cut(s)	942
Hin6I	GCGC	1 cut(s)	940
HinP1I	GCGC	1 cut(s)	940
HincII	GTYRAC	2 cut(s)	333, 1355
HindII	GTYRAC	2 cut(s)	333, 1355
HindIII	AAGCTT	4 cut(s)	51, 72, 453, 549
HphI	GGTGA	9 cut(s)	243, 613, 637, 644, 892, 919, 1056, 1300, 2677
Hpy166II	GTNNAC	6 cut(s)	333, 732, 1209, 1355, 1497, 1543
Hpy8I	GTNNAC	6 cut(s)	333, 732, 1209, 1355, 1497, 1543
Hpy99I	CGWCG	1 cut(s)	1359
HpyAV	CCTTC	7 cut(s)	142, 591, 888, 1798, 1948, 2098, 2248
HpyCH4III	ACNGT	9 cut(s)	483, 1194, 1257, 1530, 1547, 1557, 1612, 1923, 2073
HpyCH4IV	ACGT	5 cut(s)	359, 1694, 1847, 1997, 2147
HpyF10VI	GCNNNNNNNGC	4 cut(s)	19, 28, 96, 946
HpyF3I	CTNAG	9 cut(s)	1412, 1817, 1868, 1967, 2018, 2117, 2168, 2267, 2318
HpySE526I	ACGT	5 cut(s)	359, 1694, 1847, 1997, 2147
HspAI	GCGC	1 cut(s)	940
Ksp22I	TGATCA	1 cut(s)	1161
Kzo9I	GATC	8 cut(s)	627, 1161, 1362, 1730, 1750, 2338, 2497, 2512
LmnI	GCTCC	3 cut(s)	64, 723, 1389
Lsp1109I	GCAGC	9 cut(s)	548, 712, 1063, 1808, 1958, 2108, 2258, 2408, 2657
LweI	GCATC	9 cut(s)	18, 22, 328, 838, 942, 1218, 1707, 1744, 2605
MaeI	CTAG	6 cut(s)	445, 814, 1067, 1487, 1507, 1606
MaeII	ACGT	5 cut(s)	359, 1694, 1847, 1997, 2147
MaeIII	GTNAC	5 cut(s)	157, 486, 1069, 1923, 2073
MalI	GATC	8 cut(s)	629, 1163, 1364, 1732, 1752, 2340, 2499, 2514
MboI	GATC	8 cut(s)	627, 1161, 1362, 1730, 1750, 2338, 2497, 2512
MfeI	CAATTG	1 cut(s)	956
MflI	RGATCY	3 cut(s)	1362, 1750, 2512
MhlI	GDGCHC	3 cut(s)	697, 1339, 1409
MlyI	GAGTC	7 cut(s)	220, 682, 730, 856, 1387, 1469, 2575
MmeI	TCCRAC	5 cut(s)	329, 426, 440, 1109, 1239
Mph1103I	ATGCAT	2 cut(s)	33, 321
MroXI	GAANNNNTTC	1 cut(s)	345
MseI	TTAA	3 cut(s)	107, 719, 1619
MslI	CAYNNNNRTG	1 cut(s)	350
MspA1I	CMGCKG	2 cut(s)	703, 835
MspR9I	CCNGG	3 cut(s)	370, 1125, 1387
MunI	CAATTG	1 cut(s)	956
Mva1269I	GAATGC	2 cut(s)	31, 1053
MvaI	CCWGG	3 cut(s)	370, 1125, 1387
MwoI	GCNNNNNNNGC	4 cut(s)	19, 28, 96, 946
NcoI	CCATGG	2 cut(s)	336, 1139
NdeII	GATC	8 cut(s)	627, 1161, 1362, 1730, 1750, 2338, 2497, 2512
NlaIV	GGNNCC	5 cut(s)	617, 725, 927, 1364, 1752
NmuCI	GTSAC	2 cut(s)	1923, 2073
NsiI	ATGCAT	2 cut(s)	33, 321
NspI	RCATGY	1 cut(s)	22
PaeI	GCATGC	1 cut(s)	22
PagI	TCATGA	2 cut(s)	689, 1452
PctI	GAATGC	2 cut(s)	31, 1053
PdmI	GAANNNNTTC	1 cut(s)	345
PfoI	TCCNGGA	1 cut(s)	1385
PkrI	GCNGC	9 cut(s)	538, 702, 1053, 1823, 1973, 2123, 2273, 2423, 2672
PleI	GAGTC	7 cut(s)	220, 681, 730, 855, 1386, 1468, 2575
PpsI	GAGTC	7 cut(s)	220, 681, 730, 855, 1386, 1468, 2575
Psp6I	CCWGG	3 cut(s)	368, 1123, 1385
PspFI	CCCAGC	1 cut(s)	989
PspGI	CCWGG	3 cut(s)	368, 1123, 1385
PspN4I	GGNNCC	5 cut(s)	617, 725, 927, 1364, 1752
PspPI	GGNCC	1 cut(s)	615
PsuI	RGATCY	3 cut(s)	1362, 1750, 2512
PvuII	CAGCTG	1 cut(s)	703
RsaI	GTAC	4 cut(s)	128, 476, 859, 1527
RsaNI	GTAC	4 cut(s)	127, 475, 858, 1526
RseI	CAYNNNNRTG	1 cut(s)	350
SalI	GTCGAC	1 cut(s)	1353
SaqAI	TTAA	3 cut(s)	107, 719, 1619
SatI	GCNGC	9 cut(s)	537, 701, 1052, 1822, 1972, 2122, 2272, 2422, 2671
Sau3AI	GATC	8 cut(s)	627, 1161, 1362, 1730, 1750, 2338, 2497, 2512
Sau96I	GGNCC	1 cut(s)	615
SchI	GAGTC	7 cut(s)	220, 682, 730, 856, 1387, 1469, 2575
ScrFI	CCNGG	3 cut(s)	370, 1125, 1387
SduI	GDGCHC	3 cut(s)	697, 1339, 1409
SfaNI	GCATC	9 cut(s)	18, 22, 328, 838, 942, 1218, 1707, 1744, 2605
SfcI	CTRYAG	2 cut(s)	239, 2483
SinI	GGWCC	1 cut(s)	615
SmiMI	CAYNNNNRTG	1 cut(s)	350
SmlI	CTYRAG	4 cut(s)	667, 824, 1402, 2636
SmoI	CTYRAG	4 cut(s)	667, 824, 1402, 2636
SpeI	ACTAGT	1 cut(s)	813
SphI	GCATGC	1 cut(s)	22
SsiI	CCGC	6 cut(s)	655, 835, 1360, 1879, 2029, 2179
SspMI	CTAG	6 cut(s)	445, 814, 1067, 1487, 1507, 1606
StyD4I	CCNGG	3 cut(s)	368, 1123, 1385
StyI	CCWWGG	3 cut(s)	336, 1030, 1139
TaaI	ACNGT	9 cut(s)	483, 1194, 1257, 1530, 1547, 1557, 1612, 1923, 2073
TaiI	ACGT	5 cut(s)	362, 1697, 1850, 2000, 2150
TaqI	TCGA	3 cut(s)	1354, 2284, 2500
TatI	WGTACW	2 cut(s)	857, 1525
Tru1I	TTAA	3 cut(s)	107, 719, 1619
Tru9I	TTAA	3 cut(s)	107, 719, 1619
TscAI	CASTG	8 cut(s)	273, 1275, 1344, 1535, 1932, 2082, 2232, 2382
TseFI	GTSAC	2 cut(s)	1923, 2073
TseI	GCWGC	9 cut(s)	536, 700, 1051, 1821, 1971, 2121, 2271, 2421, 2670
Tsp45I	GTSAC	2 cut(s)	1923, 2073
TspGWI	ACGGA	3 cut(s)	28, 307, 2404
TspRI	CASTG	8 cut(s)	273, 1275, 1344, 1535, 1932, 2082, 2232, 2382
VpaK11BI	GGWCC	1 cut(s)	615
XapI	RAATTY	9 cut(s)	103, 580, 1035, 1448, 1836, 1986, 2136, 2286, 2436
XbaI	TCTAGA	2 cut(s)	444, 1605
XceI	RCATGY	1 cut(s)	22
XmiI	GTMKAC	3 cut(s)	731, 1354, 1496
XmnI	GAANNNNTTC	1 cut(s)	345
XspI	CTAG	6 cut(s)	445, 814, 1067, 1487, 1507, 1606
Zsp2I	ATGCAT	2 cut(s)	33, 321

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.