Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0005060.1

Orthogroup ID

OG0003273

Physical Location & Seq

Genomic Coordinates Reverse (-)

143972 .. 145290

Gene Structure 1319 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0005060.1_g000019.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 834 bp

atgaagcatcgcgtctgcaatgttagttgctggtttcttttccttgtagttctatcagtcgtcacagctcaagaagttgaggatgagagagagttcgattacgttgagggaagtgaaaaggggccaaatcattggggacaaatgaagaaagaatgggcagcctgcaacaatggaggcatgcaatctcccatcgatctttcaaacaagagagtgaagataatacccaagttggggaagctaaaaaagagttacagacctagtaatgccaccgtcaagaatagagggcacgacatttcgcttcaatgggagggcgacgcaggatcagttcggatcaacggaactgactacttgcttaaacaatgtcactggcattcgccatctgagcactccatcaacggcaggaggtatgacatggagctccatatggtccatctcagccccgatcccaatgtgacaaacaagattgctgtcgtcggagtcctttacaagtttggtcgccaccctgattctttcctctctaagttgaggaggcatgtaagatccatgactgatcgaaaggaacagagaaacatagggaagattgatccaagagaaatcaaaatgggtggcaacaactactatagatatatgggctcactaactgttcctccatgtactgaaggtgtcatttggacaatccataagcagataagaagtgtctcgagggaacaagtaaaactatttcgttcggctgtgcacgattatgcagagaggaatgcgaggccagtacaaccacttaacctccgagaaatagagatgtatgatcaaacagcaaatcaggagcaacaccaataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00910 map00910

Pfam Domains

Protein Families

Carb_anhydrase

Protein Analysis

277

Amino Acids

32.11

Weight (kDa)

9.43

Isoelectric Point (pI)

53.2

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003273)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_5g02430 FvH4_6g16680 FvH4_6g16682 FvH4_6g16682 FvH4_6g16682 FvH4_6g16690
malus_domestica	MD00G1067900.v1.1 MD03G1165000.v1.1
prunus_persica	Prupe.4G263400_v2.0.a1 Prupe.4G263500_v2.0.a1 Prupe.4G264600_v2.0.a1 Prupe.7G126600_v2.0.a1
pyrus_communis	pycom03g11960 pycom12g08900
rosa_chinensis	RchiOBHm_Chr3g0470641 RchiOBHm_Chr5g0050381
rosa_laevigata	RLG00000024251 RLG00000034701
rosa_multiflora	Rmu_co8293285.1_g000001 Rmu_co8361179.1_g000001 Rmu_sc0002115.1_g000025 Rmu_sc0005060.1_g000019 Rmu_sc0030351.1_g000001
rosa_roxburghii	Rroxscaffold_1G00030530 Rroxscaffold_6G00410640
rosa_rugosa	Rorug03G0111200 Rorug05G0260900
rosa_samantha	Rh3AG160900 Rh3BG185500 Rh3CG175800 Rh3DG189300 Rh5AG332300 Rh5BG342600 Rh5CG369800 Rh5DG355400
rosa_wichuraiana	Rw3G015220 Rw5G031410

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	1 cut(s)	12
AclWI	GGATC	5 cut(s)	328, 338, 437, 534, 578
AcuI	CTGAAG	1 cut(s)	678
AfaI	GTAC	2 cut(s)	655, 768
AfiI	CCNNNNNNNGG	2 cut(s)	230, 231
AgsI	TTSAA	2 cut(s)	201, 302
AluBI	AGCT	3 cut(s)	68, 238, 418
AluI	AGCT	3 cut(s)	68, 238, 418
Alw21I	GWGCWC	3 cut(s)	387, 420, 738
Alw26I	GTCTC	1 cut(s)	703
Alw44I	GTGCAC	1 cut(s)	734
AlwI	GGATC	5 cut(s)	328, 338, 437, 534, 578
Ama87I	CYCGRG	1 cut(s)	700
AoxI	GGCC	2 cut(s)	122, 761
ApaLI	GTGCAC	1 cut(s)	734
ApeKI	GCWGC	1 cut(s)	158
AspS9I	GGNCC	2 cut(s)	122, 427
AvaI	CYCGRG	1 cut(s)	700
AvaII	GGWCC	1 cut(s)	427
BaeGI	GKGCMC	2 cut(s)	288, 738
BanII	GRGCYC	2 cut(s)	420, 635
Bbv12I	GWGCWC	3 cut(s)	387, 420, 738
BbvI	GCAGC	1 cut(s)	170
BccI	CCATC	4 cut(s)	197, 385, 398, 438
BceAI	ACGGC	1 cut(s)	412
BclI	TGATCA	1 cut(s)	802
BcoDI	GTCTC	1 cut(s)	703
BfaI	CTAG	1 cut(s)	258
BfmI	CTRYAG	1 cut(s)	619
BisI	GCNGC	1 cut(s)	159
BlsI	GCNGC	1 cut(s)	160
Bme18I	GGWCC	1 cut(s)	427
BmeT110I	CYCGRG	1 cut(s)	700
BmgT120I	GGNCC	2 cut(s)	122, 427
BmiI	GGNNCC	1 cut(s)	123
BmsI	GCATC	1 cut(s)	16
BpuEI	CTTGAG	1 cut(s)	54
Bsa29I	ATCGAT	1 cut(s)	192
BsaXI	ACNNNNNCTCC	4 cut(s)	631, 661, 765, 795
Bsc4I	CCNNNNNNNGG	2 cut(s)	230, 231
Bse1I	ACTGG	2 cut(s)	371, 764
Bse3DI	GCAATG	1 cut(s)	25
BseCI	ATCGAT	1 cut(s)	192
BseGI	GGATG	1 cut(s)	88
BseLI	CCNNNNNNNGG	2 cut(s)	230, 231
BseMI	GCAATG	1 cut(s)	25
BseMII	CTCAG	2 cut(s)	372, 448
BseNI	ACTGG	2 cut(s)	371, 764
BseRI	GAGGAG	1 cut(s)	541
BseSI	GKGCMC	2 cut(s)	288, 738
BseXI	GCAGC	1 cut(s)	170
Bsh1236I	CGCG	1 cut(s)	12
BshFI	GGCC	2 cut(s)	124, 763
BshVI	ATCGAT	1 cut(s)	192
BsiHKAI	GWGCWC	3 cut(s)	387, 420, 738
BsiHKCI	CYCGRG	1 cut(s)	700
BslFI	GGGAC	1 cut(s)	150
BslI	CCNNNNNNNGG	2 cut(s)	230, 231
BsmAI	GTCTC	1 cut(s)	703
BsmFI	GGGAC	1 cut(s)	150
BsmI	GAATGC	2 cut(s)	370, 760
BsnI	GGCC	2 cut(s)	124, 763
BsoBI	CYCGRG	1 cut(s)	700
Bsp1286I	GDGCHC	5 cut(s)	288, 387, 420, 635, 738
Bsp143I	GATC	8 cut(s)	193, 320, 330, 442, 539, 550, 583, 802
BspANI	GGCC	2 cut(s)	124, 763
BspCNI	CTCAG	2 cut(s)	373, 447
BspDI	ATCGAT	1 cut(s)	192
BspFNI	CGCG	1 cut(s)	12
BspLI	GGNNCC	1 cut(s)	123
BspPI	GGATC	5 cut(s)	328, 338, 437, 534, 578
BsrDI	GCAATG	1 cut(s)	25
BsrI	ACTGG	2 cut(s)	371, 764
BssMI	GATC	8 cut(s)	193, 320, 330, 442, 539, 550, 583, 802
Bst4CI	ACNGT	2 cut(s)	271, 643
BstC8I	GCNNGC	2 cut(s)	163, 179
BstDEI	CTNAG	3 cut(s)	381, 434, 519
BstF5I	GGATG	1 cut(s)	88
BstFNI	CGCG	1 cut(s)	12
BstKTI	GATC	8 cut(s)	196, 323, 333, 445, 542, 553, 586, 805
BstMAI	GTCTC	1 cut(s)	703
BstMBI	GATC	8 cut(s)	193, 320, 330, 442, 539, 550, 583, 802
BstMWI	GCNNNNNNNGC	1 cut(s)	382
BstNSI	RCATGY	2 cut(s)	181, 536
BstSFI	CTRYAG	1 cut(s)	619
BstSLI	GKGCMC	2 cut(s)	288, 738
BstUI	CGCG	1 cut(s)	12
BstV1I	GCAGC	1 cut(s)	170
BstX2I	RGATCY	1 cut(s)	539
BstXI	CCANNNNNNTGG	1 cut(s)	132
BstYI	RGATCY	1 cut(s)	539
Bsu15I	ATCGAT	1 cut(s)	192
BsuRI	GGCC	2 cut(s)	124, 763
BsuTUI	ATCGAT	1 cut(s)	192
BtsCI	GGATG	1 cut(s)	88
BtsIMutI	CAGTG	1 cut(s)	364
Cac8I	GCNNGC	2 cut(s)	163, 179
Cfr13I	GGNCC	2 cut(s)	122, 427
ClaI	ATCGAT	1 cut(s)	192
CseI	GACGC	1 cut(s)	323
Csp6I	GTAC	2 cut(s)	654, 767
CspCI	CAANNNNNGTGG	2 cut(s)	586, 621
CviAII	CATG	5 cut(s)	178, 412, 533, 544, 651
CviJI	RGCY	9 cut(s)	68, 124, 161, 238, 418, 438, 633, 731, 763
CviKI_1	RGCY	9 cut(s)	68, 124, 161, 238, 418, 438, 633, 731, 763
CviQI	GTAC	2 cut(s)	654, 767
DdeI	CTNAG	3 cut(s)	381, 434, 519
DpnI	GATC	8 cut(s)	195, 322, 332, 444, 541, 552, 585, 804
DpnII	GATC	8 cut(s)	193, 320, 330, 442, 539, 550, 583, 802
Ecl136II	GAGCTC	1 cut(s)	418
Eco24I	GRGCYC	2 cut(s)	420, 635
Eco47I	GGWCC	1 cut(s)	427
Eco53kI	GAGCTC	1 cut(s)	418
Eco57I	CTGAAG	1 cut(s)	678
Eco88I	CYCGRG	1 cut(s)	700
EcoICRI	GAGCTC	1 cut(s)	418
EcoT38I	GRGCYC	2 cut(s)	420, 635
FaeI	CATG	5 cut(s)	181, 415, 536, 547, 654
FaqI	GGGAC	1 cut(s)	150
FatI	CATG	5 cut(s)	177, 411, 532, 543, 650
FauNDI	CATATG	1 cut(s)	423
FbaI	TGATCA	1 cut(s)	802
Fnu4HI	GCNGC	1 cut(s)	159
FokI	GGATG	1 cut(s)	95
FriOI	GRGCYC	2 cut(s)	420, 635
Fsp4HI	GCNGC	1 cut(s)	159
FspBI	CTAG	1 cut(s)	258
GluI	GCNGC	1 cut(s)	159
HaeIII	GGCC	2 cut(s)	124, 763
HgaI	GACGC	1 cut(s)	323
Hin1II	CATG	5 cut(s)	181, 415, 536, 547, 654
HinfI	GANTC	2 cut(s)	477, 506
Hpy166II	GTNNAC	1 cut(s)	736
Hpy188I	TCNGA	4 cut(s)	330, 382, 476, 785
Hpy188III	TCNNGA	4 cut(s)	71, 274, 700, 818
Hpy8I	GTNNAC	1 cut(s)	736
Hpy99I	CGWCG	2 cut(s)	317, 476
HpyAV	CCTTC	1 cut(s)	653
HpyCH4III	ACNGT	2 cut(s)	271, 643
HpyCH4IV	ACGT	1 cut(s)	102
HpyCH4V	TGCA	5 cut(s)	18, 165, 181, 736, 746
HpyF10VI	GCNNNNNNNGC	1 cut(s)	382
HpyF3I	CTNAG	3 cut(s)	381, 434, 519
HpySE526I	ACGT	1 cut(s)	102
Hsp92II	CATG	5 cut(s)	181, 415, 536, 547, 654
Ksp22I	TGATCA	1 cut(s)	802
Kzo9I	GATC	8 cut(s)	193, 320, 330, 442, 539, 550, 583, 802
LmnI	GCTCC	3 cut(s)	415, 423, 820
LpnPI	CCDG	8 cut(s)	16, 175, 303, 352, 385, 516, 777, 803
Lsp1109I	GCAGC	1 cut(s)	170
LweI	GCATC	1 cut(s)	16
MaeI	CTAG	1 cut(s)	258
MaeII	ACGT	1 cut(s)	102
MaeIII	GTNAC	4 cut(s)	61, 248, 362, 451
MalI	GATC	8 cut(s)	195, 322, 332, 444, 541, 552, 585, 804
MboI	GATC	8 cut(s)	193, 320, 330, 442, 539, 550, 583, 802
MboII	GAAGA	3 cut(s)	157, 226, 589
MflI	RGATCY	1 cut(s)	539
MhlI	GDGCHC	5 cut(s)	288, 387, 420, 635, 738
MlyI	GAGTC	1 cut(s)	486
MmeI	TCCRAC	1 cut(s)	454
MseI	TTAA	2 cut(s)	354, 777
MslI	CAYNNNNRTG	1 cut(s)	741
Mva1269I	GAATGC	2 cut(s)	370, 760
MvnI	CGCG	1 cut(s)	12
MwoI	GCNNNNNNNGC	1 cut(s)	382
NdeI	CATATG	1 cut(s)	423
NdeII	GATC	8 cut(s)	193, 320, 330, 442, 539, 550, 583, 802
NlaIII	CATG	5 cut(s)	181, 415, 536, 547, 654
NlaIV	GGNNCC	1 cut(s)	123
NmuCI	GTSAC	3 cut(s)	61, 362, 451
NspI	RCATGY	2 cut(s)	181, 536
PaeI	GCATGC	1 cut(s)	181
PaeR7I	CTCGAG	1 cut(s)	700
PctI	GAATGC	2 cut(s)	370, 760
PfeI	GAWTC	1 cut(s)	506
PkrI	GCNGC	1 cut(s)	160
PleI	GAGTC	1 cut(s)	485
PpsI	GAGTC	1 cut(s)	485
Psp124BI	GAGCTC	1 cut(s)	420
PspN4I	GGNNCC	1 cut(s)	123
PspPI	GGNCC	2 cut(s)	122, 427
PsuI	RGATCY	1 cut(s)	539
RsaI	GTAC	2 cut(s)	655, 768
RsaNI	GTAC	2 cut(s)	654, 767
RseI	CAYNNNNRTG	1 cut(s)	741
SacI	GAGCTC	1 cut(s)	420
SaqAI	TTAA	2 cut(s)	354, 777
SatI	GCNGC	1 cut(s)	159
Sau3AI	GATC	8 cut(s)	193, 320, 330, 442, 539, 550, 583, 802
Sau96I	GGNCC	2 cut(s)	122, 427
SchI	GAGTC	1 cut(s)	486
SduI	GDGCHC	5 cut(s)	288, 387, 420, 635, 738
SetI	ASST	8 cut(s)	70, 105, 240, 259, 407, 420, 664, 783
SfaNI	GCATC	1 cut(s)	16
SfcI	CTRYAG	1 cut(s)	619
Sfr274I	CTCGAG	1 cut(s)	700
SinI	GGWCC	1 cut(s)	427
SlaI	CTCGAG	1 cut(s)	700
SmiMI	CAYNNNNRTG	1 cut(s)	741
SmlI	CTYRAG	2 cut(s)	69, 700
SmoI	CTYRAG	2 cut(s)	69, 700
SphI	GCATGC	1 cut(s)	181
SspMI	CTAG	1 cut(s)	258
SstI	GAGCTC	1 cut(s)	420
TaaI	ACNGT	2 cut(s)	271, 643
TaiI	ACGT	1 cut(s)	105
TaqI	TCGA	4 cut(s)	96, 192, 553, 701
TatI	WGTACW	2 cut(s)	653, 766
TfiI	GAWTC	1 cut(s)	506
Tru1I	TTAA	2 cut(s)	354, 777
Tru9I	TTAA	2 cut(s)	354, 777
TscAI	CASTG	1 cut(s)	371
TseFI	GTSAC	3 cut(s)	61, 362, 451
TseI	GCWGC	1 cut(s)	158
Tsp45I	GTSAC	3 cut(s)	61, 362, 451
TspDTI	ATGAA	2 cut(s)	17, 158
TspGWI	ACGGA	1 cut(s)	351
TspRI	CASTG	1 cut(s)	371
VneI	GTGCAC	1 cut(s)	734
VpaK11BI	GGWCC	1 cut(s)	427
XceI	RCATGY	2 cut(s)	181, 536
XhoI	CTCGAG	1 cut(s)	700
XspI	CTAG	1 cut(s)	258

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.