Rmu_sc0006022.1_g000001
ERF Family

belongs to the metallo- dependent hydrolases superfamily. Urease alpha subunit family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006022.1
Physical Location & Seq
Forward (+)
69 .. 407
339 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006022.1_g000001.1.cds

Sequence Viewer

Length: 204 bp
atgaagctggttctaggagagcttgacaaattgggcctccacaatgctgggtttctagcccagaagagacttgctcgtgggttaaggctcaatcaccctgaagctgttgcactcatagccactcagatattggagtttgttagagatggtgacaaatctgtggcagagttgatggatattgggaaacagcttctagggaggtaa

Protein Analysis

67

Amino Acids

7.36

Weight (kDa)

9.39

Isoelectric Point (pI)

19.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 120
AluBI AGCT 4 cut(s) 7, 22, 104, 190
AluI AGCT 4 cut(s) 7, 22, 104, 190
Alw26I GTCTC 1 cut(s) 61
AoxI GGCC 1 cut(s) 34
AspS9I GGNCC 1 cut(s) 34
AsuHPI GGTGA 2 cut(s) 86, 161
BauI CACGAG 1 cut(s) 75
BccI CCATC 2 cut(s) 140, 166
BcoDI GTCTC 1 cut(s) 61
BfaI CTAG 3 cut(s) 14, 56, 194
BmgT120I GGNCC 1 cut(s) 34
BplI GAGNNNNNCTC 2 cut(s) 58, 90
BseMII CTCAG 1 cut(s) 137
BseYI CCCAGC 1 cut(s) 47
BshFI GGCC 1 cut(s) 36
BsmAI GTCTC 1 cut(s) 61
BsnI GGCC 1 cut(s) 36
BspANI GGCC 1 cut(s) 36
BspCNI CTCAG 1 cut(s) 136
BssSI CACGAG 1 cut(s) 75
Bst2BI CACGAG 1 cut(s) 75
Bst6I CTCTTC 1 cut(s) 59
BstDEI CTNAG 1 cut(s) 123
BstMAI GTCTC 1 cut(s) 61
BstMWI GCNNNNNNNGC 1 cut(s) 116
BstXI CCANNNNNNTGG 1 cut(s) 47
BsuRI GGCC 1 cut(s) 36
Cfr13I GGNCC 1 cut(s) 34
CviJI RGCY 8 cut(s) 7, 22, 36, 59, 88, 104, 119, 190
CviKI_1 RGCY 8 cut(s) 7, 22, 36, 59, 88, 104, 119, 190
DdeI CTNAG 1 cut(s) 123
Eam1104I CTCTTC 1 cut(s) 59
EarI CTCTTC 1 cut(s) 59
Eco57I CTGAAG 1 cut(s) 120
FaiI YATR 1 cut(s) 116
FspBI CTAG 3 cut(s) 14, 56, 194
GsaI CCCAGC 1 cut(s) 51
HaeIII GGCC 1 cut(s) 36
HphI GGTGA 2 cut(s) 86, 161
Hpy188I TCNGA 1 cut(s) 126
HpyCH4V TGCA 1 cut(s) 110
HpyF10VI GCNNNNNNNGC 1 cut(s) 116
HpyF3I CTNAG 1 cut(s) 123
LpnPI CCDG 3 cut(s) 33, 74, 111
MaeI CTAG 3 cut(s) 14, 56, 194
MaeIII GTNAC 1 cut(s) 149
MboII GAAGA 1 cut(s) 76
MluCI AATT 1 cut(s) 29
MnlI CCTC 2 cut(s) 47, 192
MseI TTAA 1 cut(s) 83
MwoI GCNNNNNNNGC 1 cut(s) 116
NmuCI GTSAC 1 cut(s) 149
PspFI CCCAGC 1 cut(s) 47
PspPI GGNCC 1 cut(s) 34
SaqAI TTAA 1 cut(s) 83
Sau96I GGNCC 1 cut(s) 34
SetI ASST 5 cut(s) 9, 24, 106, 192, 203
Sse9I AATT 1 cut(s) 29
SspMI CTAG 3 cut(s) 14, 56, 194
TasI AATT 1 cut(s) 29
Tru1I TTAA 1 cut(s) 83
Tru9I TTAA 1 cut(s) 83
TseFI GTSAC 1 cut(s) 149
Tsp45I GTSAC 1 cut(s) 149
TspDTI ATGAA 1 cut(s) 17
XcmI CCANNNNNNNNNTGG 1 cut(s) 127
XspI CTAG 3 cut(s) 14, 56, 194
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.