Rh7CG419300
ERF Family

belongs to the metallo- dependent hydrolases superfamily. Urease alpha subunit family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
OG0002839
Physical Location & Seq
Reverse (-)
54147089 .. 54147407
319 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG419300.1

Sequence Viewer

Length: 189 bp
ATGAAGCTGGTTCCAAGAGAGCTTGACAAATTGGGCCTCCACAATGCCGGGTTTCTAGCCCAAAAGAGACTTGCTCGTGGGTTAAGGCTCAATCACCCTAAAGCTGTTGCACTCATAGCCACTCAGATATTGGAGTTTGTTAGAGATGGTGACAAATCTGTGGCAGAGTTGATGGATATTGGGAAATAG

Protein Analysis

62

Amino Acids

6.88

Weight (kDa)

9.99

Isoelectric Point (pI)

17.12

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Urease_gamma PF00547 1 - 62 7.8e-23 Urease, gamma subunit
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 3 cut(s) 7, 22, 104
AluI AGCT 3 cut(s) 7, 22, 104
Alw26I GTCTC 1 cut(s) 61
AoxI GGCC 1 cut(s) 34
AspS9I GGNCC 1 cut(s) 34
AsuC2I CCSGG 1 cut(s) 49
AsuHPI GGTGA 2 cut(s) 86, 161
BauI CACGAG 1 cut(s) 75
BccI CCATC 2 cut(s) 140, 166
BcnI CCSGG 1 cut(s) 49
BcoDI GTCTC 1 cut(s) 61
BfaI CTAG 1 cut(s) 56
Bme1390I CCNGG 1 cut(s) 49
BmgT120I GGNCC 1 cut(s) 34
BmiI GGNNCC 1 cut(s) 12
BmrFI CCNGG 1 cut(s) 49
BplI GAGNNNNNCTC 2 cut(s) 58, 90
BpuMI CCSGG 1 cut(s) 49
BseMII CTCAG 1 cut(s) 137
BshFI GGCC 1 cut(s) 36
BsiSI CCGG 1 cut(s) 48
BsmAI GTCTC 1 cut(s) 61
BsnI GGCC 1 cut(s) 36
BspANI GGCC 1 cut(s) 36
BspCNI CTCAG 1 cut(s) 136
BspLI GGNNCC 1 cut(s) 12
BssSI CACGAG 1 cut(s) 75
Bst2BI CACGAG 1 cut(s) 75
BstDEI CTNAG 1 cut(s) 123
BstMAI GTCTC 1 cut(s) 61
BstMWI GCNNNNNNNGC 1 cut(s) 116
BstSCI CCNGG 1 cut(s) 47
BsuRI GGCC 1 cut(s) 36
Cfr13I GGNCC 1 cut(s) 34
CviJI RGCY 7 cut(s) 7, 22, 36, 59, 88, 104, 119
CviKI_1 RGCY 7 cut(s) 7, 22, 36, 59, 88, 104, 119
DdeI CTNAG 1 cut(s) 123
FaiI YATR 1 cut(s) 116
FspBI CTAG 1 cut(s) 56
HaeIII GGCC 1 cut(s) 36
HapII CCGG 1 cut(s) 48
HpaII CCGG 1 cut(s) 48
HphI GGTGA 2 cut(s) 86, 161
Hpy188I TCNGA 1 cut(s) 126
HpyCH4V TGCA 1 cut(s) 110
HpyF10VI GCNNNNNNNGC 1 cut(s) 116
HpyF3I CTNAG 1 cut(s) 123
LpnPI CCDG 1 cut(s) 61
MaeI CTAG 1 cut(s) 56
MaeIII GTNAC 1 cut(s) 149
MluCI AATT 1 cut(s) 29
MnlI CCTC 1 cut(s) 47
MseI TTAA 1 cut(s) 83
MspI CCGG 1 cut(s) 48
MspR9I CCNGG 1 cut(s) 49
MwoI GCNNNNNNNGC 1 cut(s) 116
NciI CCSGG 1 cut(s) 49
NlaIV GGNNCC 1 cut(s) 12
NmuCI GTSAC 1 cut(s) 149
PspN4I GGNNCC 1 cut(s) 12
PspPI GGNCC 1 cut(s) 34
SaqAI TTAA 1 cut(s) 83
Sau96I GGNCC 1 cut(s) 34
ScrFI CCNGG 1 cut(s) 49
SetI ASST 3 cut(s) 9, 24, 106
SgeI CNNG 9 cut(s) 20, 27, 35, 60, 61, 68, 83, 87, 89
Sse9I AATT 1 cut(s) 29
SspMI CTAG 1 cut(s) 56
StyD4I CCNGG 1 cut(s) 47
TasI AATT 1 cut(s) 29
Tru1I TTAA 1 cut(s) 83
Tru9I TTAA 1 cut(s) 83
TseFI GTSAC 1 cut(s) 149
Tsp45I GTSAC 1 cut(s) 149
TspDTI ATGAA 1 cut(s) 17
XcmI CCANNNNNNNNNTGG 1 cut(s) 127
XspI CTAG 1 cut(s) 56
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.