Rmu_sc0006400.1_g000001

Serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006400.1
Physical Location & Seq
Reverse (-)
2024 .. 4910
2887 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006400.1_g000001.1.cds

Sequence Viewer

Length: 972 bp
atgcatgaaatcactttctcaacagatgacaagccaaaacttctcagtcagttgacttccttgcttgcagagcttgggctgaatatccaagaagcacatgcattttccacgctggatggttactccttggatgtctttgttgttgacggctggccttacgaggaaacggagcagctcaagactgctttggaaaaggaagttttgaagattgagggaccatggccaatacatcgatcatcatcttctggtagtgaacatgatcaagtagtgatcaaatctgaacctaatcaactgattatacccaatgatgggactgatgtatgggaaattgatcctagacagttgaaatttggaaacaaagttgcatctgggtcctgtggtgatctatacaaaggtacttactgtagtcaagaagtggcgattaaagtcctcaaacctgaatgcgtaagttcagacatgcaaaaagattttgcccaggaagtctttattatgaggaaagttcgacataagaatgttgtacaattcattggtgcatgtaccaagctcccaagcctgtgtattgtaacagaatatatgtctggtggaagtgtgtatgactacttacataaacaaaagggtgtttttaagctcccatccttgctcaaggtagcaattgatgttgccaagggaatgacctacttgcaccagaataacataatccacagggatttaaaagctgccaatctcttgatggatgaaaatgaagttgtcaaggttgctgattttggggttgccagggtcaagtctcaatcaggagtaatgacagcagaaactgggacatataggtggatggctccagaggtaatagaacacaagccatatgatcacaaagctgatgtatttagctttgcacttgtgttatgggagttgctgactggaaagcttccatatgaatacttgaccccaccgtggccaagtagagagcatgaatga

Protein Analysis

323

Amino Acids

36.41

Weight (kDa)

5.6

Isoelectric Point (pI)

42.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 326
AcoI YGGCCR 2 cut(s) 221, 950
AcsI RAATTY 1 cut(s) 347
AfaI GTAC 3 cut(s) 397, 519, 538
AfiI CCNNNNNNNGG 3 cut(s) 308, 309, 948
AgsI TTSAA 2 cut(s) 205, 346
AjnI CCWGG 2 cut(s) 474, 773
AluBI AGCT 8 cut(s) 73, 175, 544, 628, 716, 872, 885, 922
AluI AGCT 8 cut(s) 73, 175, 544, 628, 716, 872, 885, 922
Alw26I GTCTC 1 cut(s) 789
AlwI GGATC 1 cut(s) 326
AlwNI CAGNNNCTG 1 cut(s) 812
AoxI GGCC 3 cut(s) 152, 221, 950
ApeKI GCWGC 2 cut(s) 172, 716
ApoI RAATTY 1 cut(s) 347
AspS9I GGNCC 2 cut(s) 215, 372
AsuHPI GGTGA 1 cut(s) 392
AvaII GGWCC 2 cut(s) 215, 372
BalI TGGCCA 2 cut(s) 223, 952
BbvI GCAGC 2 cut(s) 184, 703
BccI CCATC 5 cut(s) 110, 302, 640, 724, 823
BceAI ACGGC 1 cut(s) 163
BciT130I CCWGG 2 cut(s) 476, 775
BclI TGATCA 3 cut(s) 259, 270, 862
BcoDI GTCTC 1 cut(s) 789
BfaI CTAG 1 cut(s) 336
BfmI CTRYAG 1 cut(s) 403
BisI GCNGC 2 cut(s) 173, 717
BlsI GCNGC 2 cut(s) 174, 718
Bme1390I CCNGG 2 cut(s) 476, 775
Bme18I GGWCC 2 cut(s) 215, 372
BmgT120I GGNCC 2 cut(s) 215, 372
BmiI GGNNCC 3 cut(s) 216, 373, 834
BmrFI CCNGG 2 cut(s) 476, 775
BmrI ACTGGG 1 cut(s) 822
BmsI GCATC 1 cut(s) 374
BmuI ACTGGG 1 cut(s) 822
BpmI CTGGAG 1 cut(s) 819
BpuEI CTTGAG 2 cut(s) 161, 626
Bsa29I ATCGAT 1 cut(s) 232
BsaBI GATNNNNATC 1 cut(s) 238
BsaJI CCNNGG 6 cut(s) 126, 218, 474, 663, 774, 947
Bsc4I CCNNNNNNNGG 3 cut(s) 308, 309, 948
Bse1I ACTGG 2 cut(s) 817, 919
Bse8I GATNNNNATC 1 cut(s) 238
BseBI CCWGG 2 cut(s) 476, 775
BseCI ATCGAT 1 cut(s) 232
BseDI CCNNGG 6 cut(s) 126, 218, 474, 663, 774, 947
BseGI GGATG 5 cut(s) 121, 136, 632, 739, 834
BseJI GATNNNNATC 1 cut(s) 238
BseLI CCNNNNNNNGG 3 cut(s) 308, 309, 948
BseMII CTCAG 1 cut(s) 58
BseNI ACTGG 2 cut(s) 817, 919
BseXI GCAGC 2 cut(s) 184, 703
BshFI GGCC 3 cut(s) 154, 223, 952
BshVI ATCGAT 1 cut(s) 232
BslFI GGGAC 3 cut(s) 228, 325, 829
BslI CCNNNNNNNGG 3 cut(s) 308, 309, 948
BsmAI GTCTC 1 cut(s) 789
BsmFI GGGAC 3 cut(s) 228, 325, 829
BsmI GAATGC 1 cut(s) 446
BsnI GGCC 3 cut(s) 154, 223, 952
Bsp1407I TGTACA 1 cut(s) 517
Bsp143I GATC 6 cut(s) 233, 259, 270, 331, 382, 862
Bsp19I CCATGG 1 cut(s) 218
BspANI GGCC 3 cut(s) 154, 223, 952
BspCNI CTCAG 1 cut(s) 57
BspDI ATCGAT 1 cut(s) 232
BspLI GGNNCC 3 cut(s) 216, 373, 834
BspPI GGATC 1 cut(s) 326
BsrGI TGTACA 1 cut(s) 517
BsrI ACTGG 2 cut(s) 817, 919
BssECI CCNNGG 6 cut(s) 126, 218, 474, 663, 774, 947
BssMI GATC 6 cut(s) 233, 259, 270, 331, 382, 862
BssT1I CCWWGG 3 cut(s) 126, 218, 663
Bst2UI CCWGG 2 cut(s) 476, 775
Bst4CI ACNGT 3 cut(s) 342, 404, 948
BstAUI TGTACA 1 cut(s) 517
BstC8I GCNNGC 2 cut(s) 66, 152
BstDEI CTNAG 1 cut(s) 44
BstDSI CCRYGG 2 cut(s) 218, 947
BstF5I GGATG 5 cut(s) 121, 136, 632, 739, 834
BstKTI GATC 6 cut(s) 236, 262, 273, 334, 385, 865
BstMAI GTCTC 1 cut(s) 789
BstMBI GATC 6 cut(s) 233, 259, 270, 331, 382, 862
BstMWI GCNNNNNNNGC 1 cut(s) 70
BstNI CCWGG 2 cut(s) 476, 775
BstNSI RCATGY 3 cut(s) 101, 460, 537
BstSCI CCNGG 2 cut(s) 474, 773
BstSFI CTRYAG 1 cut(s) 403
BstV1I GCAGC 2 cut(s) 184, 703
Bsu15I ATCGAT 1 cut(s) 232
BsuRI GGCC 3 cut(s) 154, 223, 952
BsuTUI ATCGAT 1 cut(s) 232
BtgI CCRYGG 2 cut(s) 218, 947
BtsCI GGATG 5 cut(s) 121, 136, 632, 739, 834
Cac8I GCNNGC 2 cut(s) 66, 152
CaiI CAGNNNCTG 1 cut(s) 812
Cfr13I GGNCC 2 cut(s) 215, 372
ClaI ATCGAT 1 cut(s) 232
Csp6I GTAC 3 cut(s) 396, 518, 537
CviAII CATG 7 cut(s) 5, 98, 219, 257, 457, 534, 965
CviQI GTAC 3 cut(s) 396, 518, 537
DdeI CTNAG 1 cut(s) 44
DpnI GATC 6 cut(s) 235, 261, 272, 333, 384, 864
DpnII GATC 6 cut(s) 233, 259, 270, 331, 382, 862
DraI TTTAAA 1 cut(s) 711
EaeI YGGCCR 2 cut(s) 221, 950
Eco130I CCWWGG 3 cut(s) 126, 218, 663
Eco47I GGWCC 2 cut(s) 215, 372
EcoO109I RGGNCCY 1 cut(s) 372
EcoRII CCWGG 2 cut(s) 474, 773
EcoT14I CCWWGG 3 cut(s) 126, 218, 663
EcoT22I ATGCAT 2 cut(s) 6, 103
ErhI CCWWGG 3 cut(s) 126, 218, 663
FaeI CATG 7 cut(s) 8, 101, 222, 260, 460, 537, 968
FaqI GGGAC 3 cut(s) 228, 325, 829
FatI CATG 7 cut(s) 4, 97, 218, 256, 456, 533, 964
FauNDI CATATG 2 cut(s) 859, 928
FbaI TGATCA 3 cut(s) 259, 270, 862
Fnu4HI GCNGC 2 cut(s) 173, 717
FokI GGATG 5 cut(s) 128, 143, 619, 746, 841
Fsp4HI GCNGC 2 cut(s) 173, 717
FspBI CTAG 1 cut(s) 336
GluI GCNGC 2 cut(s) 173, 717
GsuI CTGGAG 1 cut(s) 819
HaeIII GGCC 3 cut(s) 154, 223, 952
Hin1II CATG 7 cut(s) 8, 101, 222, 260, 460, 537, 968
HincII GTYRAC 2 cut(s) 54, 145
HindII GTYRAC 2 cut(s) 54, 145
HindIII AAGCTT 1 cut(s) 920
HphI GGTGA 1 cut(s) 392
Hpy166II GTNNAC 3 cut(s) 54, 145, 254
Hpy188I TCNGA 2 cut(s) 280, 454
Hpy188III TCNNGA 5 cut(s) 178, 410, 727, 792, 836
Hpy8I GTNNAC 3 cut(s) 54, 145, 254
HpyCH4III ACNGT 3 cut(s) 342, 404, 948
HpyCH4V TGCA 8 cut(s) 4, 68, 101, 365, 460, 533, 682, 890
HpyF10VI GCNNNNNNNGC 1 cut(s) 70
HpyF3I CTNAG 1 cut(s) 44
Hsp92II CATG 7 cut(s) 8, 101, 222, 260, 460, 537, 968
Ksp22I TGATCA 3 cut(s) 259, 270, 862
Kzo9I GATC 6 cut(s) 233, 259, 270, 331, 382, 862
LmnI GCTCC 4 cut(s) 169, 549, 633, 838
Lsp1109I GCAGC 2 cut(s) 184, 703
LweI GCATC 1 cut(s) 374
MaeI CTAG 1 cut(s) 336
MaeIII GTNAC 2 cut(s) 119, 562
MalI GATC 6 cut(s) 235, 261, 272, 333, 384, 864
MboI GATC 6 cut(s) 233, 259, 270, 331, 382, 862
MboII GAAGA 2 cut(s) 217, 234
MfeI CAATTG 1 cut(s) 651
MlsI TGGCCA 2 cut(s) 223, 952
MluCI AATT 4 cut(s) 327, 347, 521, 651
MluNI TGGCCA 2 cut(s) 223, 952
MnlI CCTC 5 cut(s) 154, 205, 440, 486, 832
Mox20I TGGCCA 2 cut(s) 223, 952
Mph1103I ATGCAT 2 cut(s) 6, 103
MscI TGGCCA 2 cut(s) 223, 952
MseI TTAA 3 cut(s) 423, 624, 710
MslI CAYNNNNRTG 2 cut(s) 510, 823
Msp20I TGGCCA 2 cut(s) 223, 952
MspR9I CCNGG 2 cut(s) 476, 775
MunI CAATTG 1 cut(s) 651
Mva1269I GAATGC 1 cut(s) 446
MvaI CCWGG 2 cut(s) 476, 775
MwoI GCNNNNNNNGC 1 cut(s) 70
NcoI CCATGG 1 cut(s) 218
NdeI CATATG 2 cut(s) 859, 928
NdeII GATC 6 cut(s) 233, 259, 270, 331, 382, 862
NlaIII CATG 7 cut(s) 8, 101, 222, 260, 460, 537, 968
NlaIV GGNNCC 3 cut(s) 216, 373, 834
NsiI ATGCAT 2 cut(s) 6, 103
NspI RCATGY 3 cut(s) 101, 460, 537
PctI GAATGC 1 cut(s) 446
PkrI GCNGC 2 cut(s) 174, 718
PpuMI RGGWCCY 1 cut(s) 372
Psp5II RGGWCCY 1 cut(s) 372
Psp6I CCWGG 2 cut(s) 474, 773
PspGI CCWGG 2 cut(s) 474, 773
PspN4I GGNNCC 3 cut(s) 216, 373, 834
PspPI GGNCC 2 cut(s) 215, 372
PspPPI RGGWCCY 1 cut(s) 372
PstNI CAGNNNCTG 1 cut(s) 812
RsaI GTAC 3 cut(s) 397, 519, 538
RsaNI GTAC 3 cut(s) 396, 518, 537
RseI CAYNNNNRTG 2 cut(s) 510, 823
SaqAI TTAA 3 cut(s) 423, 624, 710
SatI GCNGC 2 cut(s) 173, 717
Sau3AI GATC 6 cut(s) 233, 259, 270, 331, 382, 862
Sau96I GGNCC 2 cut(s) 215, 372
ScrFI CCNGG 2 cut(s) 476, 775
SfaNI GCATC 1 cut(s) 374
SfcI CTRYAG 1 cut(s) 403
SinI GGWCC 2 cut(s) 215, 372
SmiMI CAYNNNNRTG 2 cut(s) 510, 823
SmlI CTYRAG 2 cut(s) 176, 641
SmoI CTYRAG 2 cut(s) 176, 641
Sse9I AATT 4 cut(s) 327, 347, 521, 651
SspMI CTAG 1 cut(s) 336
StyD4I CCNGG 2 cut(s) 474, 773
StyI CCWWGG 3 cut(s) 126, 218, 663
TaaI ACNGT 3 cut(s) 342, 404, 948
TaqI TCGA 2 cut(s) 232, 502
TasI AATT 4 cut(s) 327, 347, 521, 651
TatI WGTACW 1 cut(s) 517
Tru1I TTAA 3 cut(s) 423, 624, 710
Tru9I TTAA 3 cut(s) 423, 624, 710
TseI GCWGC 2 cut(s) 172, 716
TspDTI ATGAA 5 cut(s) 21, 514, 750, 756, 945
TspGWI ACGGA 1 cut(s) 182
VpaK11BI GGWCC 2 cut(s) 215, 372
XapI RAATTY 1 cut(s) 347
XceI RCATGY 3 cut(s) 101, 460, 537
XcmI CCANNNNNNNNNTGG 1 cut(s) 727
XspI CTAG 1 cut(s) 336
Zsp2I ATGCAT 2 cut(s) 6, 103
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.