Rmu_sc0014203.1_g000019

Serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0014203.1
Physical Location & Seq
Forward (+)
54614 .. 58021
3408 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0014203.1_g000019.1.cds

Sequence Viewer

Length: 1185 bp
atgcatgaaatcactttctcaacagatgacaagccaaaacttctcagtcagttgacttccttgcttgcagagcttgggctgaatatccaagaagcacatgcattttccacgctggatggttactccttggatgtctttgttgttgacggctggccttacgaggaaacggagcagctcaagactgctttggaaaaggaagttttgaagattgagggaccatggccaatacatcgatcatcatcttctggtagtgaacatgatcaagtagtgatcaaatctgaacctaatcaactgattatacccaatgatgggactgatgtatgggaaattgatcctagacagttgaaatttggaaacaaagttgcatctgggtcctgtggtgatctatacaaaggtacttactgtagtcaagaagtggcgattaaagtcctcaaacctgaatgcgtaagttcagacatgcaaaaagattttgcccaggaagtctttattatgaggaaagttcgacataagaatgttgtacaattcattggtgcatgtaccaagctcccaagcctgtgtattgtaacagaatatatgtctggtggaagtgtgtatgactacttacataaacaaaagggtgtttttaagctcccatccttgctcaaggtagcaattgatgttgccaagggaatgacctacttgcaccagaataacataatccacagggatttaaaagctgccaatctcttgatggatgaaaatgaagttgtcaaggttgctgattttggggttgccagggtcaagtctcaatcaggagtaatgacagcagaaactgggacatataggtggatggctccagaggtaatagaacacaagccatatgatcacaaagctgatgtatttagctttgcacttgtgttatgggagttgctgactggaaagcttccatatgaatacttgaccccactacaagctgctgttggagtggtccaaaagggcttacggccaaccattccaaagcaaactcatccaaagcttactgagttacttgagaaatgctggcaacaagatccagcattaagacccgacttctcagaaatcatagagatgctgcagccattagccaaggagattggtgatgaaggagaagaacgacgcaagtcatctggaggatttctgtccgtccttagacgaggtcatcactaa

Protein Analysis

394

Amino Acids

44.27

Weight (kDa)

5.94

Isoelectric Point (pI)

48.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 326, 1043
AcoI YGGCCR 2 cut(s) 221, 983
AcsI RAATTY 1 cut(s) 347
AfaI GTAC 3 cut(s) 397, 519, 538
AfiI CCNNNNNNNGG 2 cut(s) 308, 309
AgsI TTSAA 2 cut(s) 205, 346
AjnI CCWGG 2 cut(s) 474, 773
Alw26I GTCTC 1 cut(s) 789
AlwI GGATC 2 cut(s) 326, 1043
AlwNI CAGNNNCTG 1 cut(s) 812
AoxI GGCC 3 cut(s) 152, 221, 983
ApeKI GCWGC 5 cut(s) 172, 716, 953, 1090, 1093
ApoI RAATTY 1 cut(s) 347
AspS9I GGNCC 3 cut(s) 215, 372, 967
AsuHPI GGTGA 2 cut(s) 392, 1127
AvaII GGWCC 3 cut(s) 215, 372, 967
BalI TGGCCA 1 cut(s) 223
BbvI GCAGC 5 cut(s) 184, 703, 940, 1077, 1105
BccI CCATC 5 cut(s) 110, 302, 640, 724, 823
BceAI ACGGC 2 cut(s) 163, 998
BciT130I CCWGG 2 cut(s) 476, 775
BclI TGATCA 3 cut(s) 259, 270, 862
BcoDI GTCTC 1 cut(s) 789
BfaI CTAG 1 cut(s) 336
BfmI CTRYAG 2 cut(s) 403, 1091
BisI GCNGC 5 cut(s) 173, 717, 954, 1091, 1094
BlsI GCNGC 5 cut(s) 174, 718, 955, 1092, 1095
Bme1390I CCNGG 2 cut(s) 476, 775
Bme18I GGWCC 3 cut(s) 215, 372, 967
BmgT120I GGNCC 3 cut(s) 215, 372, 967
BmiI GGNNCC 3 cut(s) 216, 373, 834
BmrFI CCNGG 2 cut(s) 476, 775
BmrI ACTGGG 1 cut(s) 822
BmsI GCATC 2 cut(s) 374, 1077
BmuI ACTGGG 1 cut(s) 822
BoxI GACNNNNGTC 1 cut(s) 1138
BpmI CTGGAG 2 cut(s) 819, 1167
BpuEI CTTGAG 3 cut(s) 161, 626, 1049
Bsa29I ATCGAT 1 cut(s) 232
BsaBI GATNNNNATC 1 cut(s) 238
BsaJI CCNNGG 6 cut(s) 126, 218, 474, 663, 774, 1104
Bsc4I CCNNNNNNNGG 2 cut(s) 308, 309
Bse1I ACTGG 2 cut(s) 817, 919
Bse8I GATNNNNATC 1 cut(s) 238
BseBI CCWGG 2 cut(s) 476, 775
BseCI ATCGAT 1 cut(s) 232
BseDI CCNNGG 6 cut(s) 126, 218, 474, 663, 774, 1104
BseGI GGATG 6 cut(s) 121, 136, 632, 739, 834, 1006
BseJI GATNNNNATC 1 cut(s) 238
BseLI CCNNNNNNNGG 2 cut(s) 308, 309
BseMII CTCAG 3 cut(s) 58, 1011, 1086
BseNI ACTGG 2 cut(s) 817, 919
BseXI GCAGC 5 cut(s) 184, 703, 940, 1077, 1105
BshFI GGCC 3 cut(s) 154, 223, 985
BshVI ATCGAT 1 cut(s) 232
BslFI GGGAC 3 cut(s) 228, 325, 829
BslI CCNNNNNNNGG 2 cut(s) 308, 309
BsmAI GTCTC 1 cut(s) 789
BsmFI GGGAC 3 cut(s) 228, 325, 829
BsmI GAATGC 1 cut(s) 446
BsnI GGCC 3 cut(s) 154, 223, 985
Bsp1407I TGTACA 1 cut(s) 517
Bsp143I GATC 7 cut(s) 233, 259, 270, 331, 382, 862, 1048
Bsp19I CCATGG 1 cut(s) 218
BspANI GGCC 3 cut(s) 154, 223, 985
BspCNI CTCAG 3 cut(s) 57, 1012, 1085
BspDI ATCGAT 1 cut(s) 232
BspLI GGNNCC 3 cut(s) 216, 373, 834
BspMAI CTGCAG 1 cut(s) 1095
BspPI GGATC 2 cut(s) 326, 1043
BsrGI TGTACA 1 cut(s) 517
BsrI ACTGG 2 cut(s) 817, 919
BssECI CCNNGG 6 cut(s) 126, 218, 474, 663, 774, 1104
BssMI GATC 7 cut(s) 233, 259, 270, 331, 382, 862, 1048
BssT1I CCWWGG 4 cut(s) 126, 218, 663, 1104
Bst2UI CCWGG 2 cut(s) 476, 775
Bst4CI ACNGT 2 cut(s) 342, 404
BstAUI TGTACA 1 cut(s) 517
BstC8I GCNNGC 3 cut(s) 66, 152, 1040
BstDEI CTNAG 4 cut(s) 44, 1020, 1072, 1166
BstDSI CCRYGG 1 cut(s) 218
BstF5I GGATG 6 cut(s) 121, 136, 632, 739, 834, 1006
BstKTI GATC 7 cut(s) 236, 262, 273, 334, 385, 865, 1051
BstMAI GTCTC 1 cut(s) 789
BstMBI GATC 7 cut(s) 233, 259, 270, 331, 382, 862, 1048
BstMWI GCNNNNNNNGC 1 cut(s) 70
BstNI CCWGG 2 cut(s) 476, 775
BstNSI RCATGY 3 cut(s) 101, 460, 537
BstPAI GACNNNNGTC 1 cut(s) 1138
BstSCI CCNGG 2 cut(s) 474, 773
BstSFI CTRYAG 2 cut(s) 403, 1091
BstV1I GCAGC 5 cut(s) 184, 703, 940, 1077, 1105
BstX2I RGATCY 1 cut(s) 1048
BstYI RGATCY 1 cut(s) 1048
Bsu15I ATCGAT 1 cut(s) 232
BsuRI GGCC 3 cut(s) 154, 223, 985
BsuTUI ATCGAT 1 cut(s) 232
BtgI CCRYGG 1 cut(s) 218
BtsCI GGATG 6 cut(s) 121, 136, 632, 739, 834, 1006
Cac8I GCNNGC 3 cut(s) 66, 152, 1040
CaiI CAGNNNCTG 1 cut(s) 812
Cfr13I GGNCC 3 cut(s) 215, 372, 967
ClaI ATCGAT 1 cut(s) 232
CseI GACGC 1 cut(s) 1143
Csp6I GTAC 3 cut(s) 396, 518, 537
CviAII CATG 6 cut(s) 5, 98, 219, 257, 457, 534
CviQI GTAC 3 cut(s) 396, 518, 537
DdeI CTNAG 4 cut(s) 44, 1020, 1072, 1166
DpnI GATC 7 cut(s) 235, 261, 272, 333, 384, 864, 1050
DpnII GATC 7 cut(s) 233, 259, 270, 331, 382, 862, 1048
DraI TTTAAA 1 cut(s) 711
EaeI YGGCCR 2 cut(s) 221, 983
Eco130I CCWWGG 4 cut(s) 126, 218, 663, 1104
Eco47I GGWCC 3 cut(s) 215, 372, 967
EcoO109I RGGNCCY 1 cut(s) 372
EcoRII CCWGG 2 cut(s) 474, 773
EcoT14I CCWWGG 4 cut(s) 126, 218, 663, 1104
EcoT22I ATGCAT 2 cut(s) 6, 103
ErhI CCWWGG 4 cut(s) 126, 218, 663, 1104
FaeI CATG 6 cut(s) 8, 101, 222, 260, 460, 537
FaqI GGGAC 3 cut(s) 228, 325, 829
FatI CATG 6 cut(s) 4, 97, 218, 256, 456, 533
FauNDI CATATG 2 cut(s) 859, 928
FbaI TGATCA 3 cut(s) 259, 270, 862
Fnu4HI GCNGC 5 cut(s) 173, 717, 954, 1091, 1094
FokI GGATG 6 cut(s) 128, 143, 619, 746, 841, 993
Fsp4HI GCNGC 5 cut(s) 173, 717, 954, 1091, 1094
FspBI CTAG 1 cut(s) 336
GluI GCNGC 5 cut(s) 173, 717, 954, 1091, 1094
GsuI CTGGAG 2 cut(s) 819, 1167
HaeIII GGCC 3 cut(s) 154, 223, 985
HgaI GACGC 1 cut(s) 1143
Hin1II CATG 6 cut(s) 8, 101, 222, 260, 460, 537
HincII GTYRAC 2 cut(s) 54, 145
HindII GTYRAC 2 cut(s) 54, 145
HindIII AAGCTT 2 cut(s) 920, 1013
HphI GGTGA 2 cut(s) 392, 1127
Hpy166II GTNNAC 3 cut(s) 54, 145, 254
Hpy188I TCNGA 3 cut(s) 280, 454, 1075
Hpy188III TCNNGA 6 cut(s) 178, 410, 727, 792, 836, 1146
Hpy8I GTNNAC 3 cut(s) 54, 145, 254
Hpy99I CGWCG 1 cut(s) 1137
HpyAV CCTTC 1 cut(s) 1115
HpyCH4III ACNGT 2 cut(s) 342, 404
HpyCH4V TGCA 9 cut(s) 4, 68, 101, 365, 460, 533, 682, 890, 1093
HpyF10VI GCNNNNNNNGC 1 cut(s) 70
HpyF3I CTNAG 4 cut(s) 44, 1020, 1072, 1166
Hsp92II CATG 6 cut(s) 8, 101, 222, 260, 460, 537
Ksp22I TGATCA 3 cut(s) 259, 270, 862
Kzo9I GATC 7 cut(s) 233, 259, 270, 331, 382, 862, 1048
LmnI GCTCC 4 cut(s) 169, 549, 633, 838
Lsp1109I GCAGC 5 cut(s) 184, 703, 940, 1077, 1105
LweI GCATC 2 cut(s) 374, 1077
MaeI CTAG 1 cut(s) 336
MaeIII GTNAC 3 cut(s) 119, 562, 1023
MalI GATC 7 cut(s) 235, 261, 272, 333, 384, 864, 1050
MboI GATC 7 cut(s) 233, 259, 270, 331, 382, 862, 1048
MboII GAAGA 3 cut(s) 217, 234, 1139
MfeI CAATTG 1 cut(s) 651
MflI RGATCY 1 cut(s) 1048
MlsI TGGCCA 1 cut(s) 223
MluCI AATT 4 cut(s) 327, 347, 521, 651
MluNI TGGCCA 1 cut(s) 223
MmeI TCCRAC 1 cut(s) 940
MnlI CCTC 7 cut(s) 154, 205, 440, 486, 832, 1142, 1166
Mox20I TGGCCA 1 cut(s) 223
Mph1103I ATGCAT 2 cut(s) 6, 103
MscI TGGCCA 1 cut(s) 223
MseI TTAA 4 cut(s) 423, 624, 710, 1058
MslI CAYNNNNRTG 3 cut(s) 510, 823, 1085
Msp20I TGGCCA 1 cut(s) 223
MspR9I CCNGG 2 cut(s) 476, 775
MunI CAATTG 1 cut(s) 651
Mva1269I GAATGC 1 cut(s) 446
MvaI CCWGG 2 cut(s) 476, 775
MwoI GCNNNNNNNGC 1 cut(s) 70
NcoI CCATGG 1 cut(s) 218
NdeI CATATG 2 cut(s) 859, 928
NdeII GATC 7 cut(s) 233, 259, 270, 331, 382, 862, 1048
NlaIII CATG 6 cut(s) 8, 101, 222, 260, 460, 537
NlaIV GGNNCC 3 cut(s) 216, 373, 834
NsiI ATGCAT 2 cut(s) 6, 103
NspI RCATGY 3 cut(s) 101, 460, 537
PctI GAATGC 1 cut(s) 446
PflFI GACNNNGTC 1 cut(s) 1173
PkrI GCNGC 5 cut(s) 174, 718, 955, 1092, 1095
PpuMI RGGWCCY 1 cut(s) 372
PshAI GACNNNNGTC 1 cut(s) 1138
Psp5II RGGWCCY 1 cut(s) 372
Psp6I CCWGG 2 cut(s) 474, 773
PspGI CCWGG 2 cut(s) 474, 773
PspN4I GGNNCC 3 cut(s) 216, 373, 834
PspPI GGNCC 3 cut(s) 215, 372, 967
PspPPI RGGWCCY 1 cut(s) 372
PstI CTGCAG 1 cut(s) 1095
PstNI CAGNNNCTG 1 cut(s) 812
PsuI RGATCY 1 cut(s) 1048
PsyI GACNNNGTC 1 cut(s) 1173
RsaI GTAC 3 cut(s) 397, 519, 538
RsaNI GTAC 3 cut(s) 396, 518, 537
RseI CAYNNNNRTG 3 cut(s) 510, 823, 1085
SaqAI TTAA 4 cut(s) 423, 624, 710, 1058
SatI GCNGC 5 cut(s) 173, 717, 954, 1091, 1094
Sau3AI GATC 7 cut(s) 233, 259, 270, 331, 382, 862, 1048
Sau96I GGNCC 3 cut(s) 215, 372, 967
ScrFI CCNGG 2 cut(s) 476, 775
SfaNI GCATC 2 cut(s) 374, 1077
SfcI CTRYAG 2 cut(s) 403, 1091
SinI GGWCC 3 cut(s) 215, 372, 967
SmiMI CAYNNNNRTG 3 cut(s) 510, 823, 1085
SmlI CTYRAG 3 cut(s) 176, 641, 1028
SmoI CTYRAG 3 cut(s) 176, 641, 1028
Sse9I AATT 4 cut(s) 327, 347, 521, 651
SspMI CTAG 1 cut(s) 336
StyD4I CCNGG 2 cut(s) 474, 773
StyI CCWWGG 4 cut(s) 126, 218, 663, 1104
TaaI ACNGT 2 cut(s) 342, 404
TaqI TCGA 2 cut(s) 232, 502
TasI AATT 4 cut(s) 327, 347, 521, 651
TatI WGTACW 1 cut(s) 517
Tru1I TTAA 4 cut(s) 423, 624, 710, 1058
Tru9I TTAA 4 cut(s) 423, 624, 710, 1058
TseI GCWGC 5 cut(s) 172, 716, 953, 1090, 1093
TspDTI ATGAA 6 cut(s) 21, 514, 750, 756, 945, 1134
TspGWI ACGGA 2 cut(s) 182, 1150
Tth111I GACNNNGTC 1 cut(s) 1173
VpaK11BI GGWCC 3 cut(s) 215, 372, 967
XapI RAATTY 1 cut(s) 347
XceI RCATGY 3 cut(s) 101, 460, 537
XcmI CCANNNNNNNNNTGG 1 cut(s) 727
XspI CTAG 1 cut(s) 336
Zsp2I ATGCAT 2 cut(s) 6, 103
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.