Rmu_sc0006537.1_g000039

UPF0496 protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006537.1
OG0007544
Physical Location & Seq
Reverse (-)
156364 .. 156792
429 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006537.1_g000039.1.cds

Sequence Viewer

Length: 429 bp
atgtctatgactctgaactttctcggaggagcaccttttcaactgctctatgatggggttaagttggcccttagcaataccaggaagtttaaaaccaacctcagaagtctcaaattcactctagattgtttacagccacagatcatcgaacagattagattgcagaacatgcagctgaatcttgccgtccaagagatacaagaacttcagaggaaaatggatgagggcatagtgctcattgaccggttgtcgagcctcagcacttggaacatctgcatctggggcgattgctgcaactgcatgacgcctggttatgcggaccagcttgatgagttgaacgaatctcttagacgtctgctagaaatactgaggctgcagtcaatagcgcaagtcaaccaggtcgtgattttggtaaggacaacatgttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF677

Protein Analysis

142

Amino Acids

16.29

Weight (kDa)

6.24

Isoelectric Point (pI)

58.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 355
AciI CCGC 1 cut(s) 317
AcsI RAATTY 1 cut(s) 113
AcuI CTGAAG 1 cut(s) 191
AcyI GRCGYC 2 cut(s) 305, 352
AflIII ACRYGT 1 cut(s) 422
AgeI ACCGGT 1 cut(s) 243
AgsI TTSAA 2 cut(s) 41, 337
AhdI GACNNNNNGTC 1 cut(s) 247
AjnI CCWGG 3 cut(s) 80, 307, 396
AluBI AGCT 2 cut(s) 175, 325
AluI AGCT 2 cut(s) 175, 325
Alw21I GWGCWC 2 cut(s) 34, 237
Alw26I GTCTC 1 cut(s) 113
AoxI GGCC 1 cut(s) 66
ApeKI GCWGC 3 cut(s) 172, 291, 373
ApoI RAATTY 1 cut(s) 113
AsiGI ACCGGT 1 cut(s) 243
AspLEI GCGC 1 cut(s) 388
AspS9I GGNCC 2 cut(s) 67, 319
AvaII GGWCC 1 cut(s) 319
Bbv12I GWGCWC 2 cut(s) 34, 237
BbvCI CCTCAGC 1 cut(s) 257
BbvI GCAGC 3 cut(s) 184, 278, 360
BccI CCATC 1 cut(s) 47
BceAI ACGGC 1 cut(s) 170
BciT130I CCWGG 3 cut(s) 82, 309, 398
BcoDI GTCTC 1 cut(s) 113
BfaI CTAG 2 cut(s) 122, 359
BfmI CTRYAG 1 cut(s) 374
BisI GCNGC 3 cut(s) 173, 292, 374
BlsI GCNGC 3 cut(s) 174, 293, 375
Bme1390I CCNGG 3 cut(s) 82, 309, 398
Bme18I GGWCC 1 cut(s) 319
BmeRI GACNNNNNGTC 1 cut(s) 247
BmgT120I GGNCC 2 cut(s) 67, 319
BmrFI CCNGG 3 cut(s) 82, 309, 398
BmsI GCATC 1 cut(s) 285
Bpu10I CCTNAGC 2 cut(s) 71, 257
BsaHI GRCGYC 2 cut(s) 305, 352
BsaWI WCCGGW 1 cut(s) 243
Bse118I RCCGGY 1 cut(s) 243
BseBI CCWGG 3 cut(s) 82, 309, 398
BseGI GGATG 1 cut(s) 226
BseMII CTCAG 3 cut(s) 115, 271, 359
BseRI GAGGAG 1 cut(s) 42
BseXI GCAGC 3 cut(s) 184, 278, 360
BshFI GGCC 1 cut(s) 68
BshTI ACCGGT 1 cut(s) 243
BsiHKAI GWGCWC 2 cut(s) 34, 237
BsiSI CCGG 1 cut(s) 244
BsmAI GTCTC 1 cut(s) 113
BsnI GGCC 1 cut(s) 68
Bsp1286I GDGCHC 2 cut(s) 34, 237
Bsp143I GATC 1 cut(s) 141
BspACI CCGC 1 cut(s) 317
BspANI GGCC 1 cut(s) 68
BspCNI CTCAG 3 cut(s) 114, 270, 360
BspMAI CTGCAG 1 cut(s) 378
BsrFI RCCGGY 1 cut(s) 243
BssAI RCCGGY 1 cut(s) 243
BssMI GATC 1 cut(s) 141
BssNI GRCGYC 2 cut(s) 305, 352
Bst2UI CCWGG 3 cut(s) 82, 309, 398
BstACI GRCGYC 2 cut(s) 305, 352
BstAPI GCANNNNNTGC 1 cut(s) 169
BstDEI CTNAG 5 cut(s) 71, 101, 257, 347, 368
BstF5I GGATG 1 cut(s) 226
BstHHI GCGC 1 cut(s) 388
BstKTI GATC 1 cut(s) 144
BstMAI GTCTC 1 cut(s) 113
BstMBI GATC 1 cut(s) 141
BstMWI GCNNNNNNNGC 4 cut(s) 169, 282, 291, 297
BstNI CCWGG 3 cut(s) 82, 309, 398
BstNSI RCATGY 2 cut(s) 172, 426
BstSCI CCNGG 3 cut(s) 80, 307, 396
BstSFI CTRYAG 1 cut(s) 374
BstV1I GCAGC 3 cut(s) 184, 278, 360
BsuRI GGCC 1 cut(s) 68
BtsCI GGATG 1 cut(s) 226
CfoI GCGC 1 cut(s) 388
Cfr10I RCCGGY 1 cut(s) 243
Cfr13I GGNCC 2 cut(s) 67, 319
CseI GACGC 1 cut(s) 313
CsiI ACCWGGT 1 cut(s) 396
CspAI ACCGGT 1 cut(s) 243
CviAII CATG 3 cut(s) 169, 301, 423
CviJI RGCY 6 cut(s) 68, 136, 175, 255, 325, 373
CviKI_1 RGCY 6 cut(s) 68, 136, 175, 255, 325, 373
DdeI CTNAG 5 cut(s) 71, 101, 257, 347, 368
DpnI GATC 1 cut(s) 143
DpnII GATC 1 cut(s) 141
DraI TTTAAA 1 cut(s) 91
DriI GACNNNNNGTC 1 cut(s) 247
Eam1105I GACNNNNNGTC 1 cut(s) 247
Eco47I GGWCC 1 cut(s) 319
Eco57I CTGAAG 1 cut(s) 191
EcoRII CCWGG 3 cut(s) 80, 307, 396
FaeI CATG 3 cut(s) 172, 304, 426
FaiI YATR 7 cut(s) 8, 51, 170, 230, 302, 315, 424
FatI CATG 3 cut(s) 168, 300, 422
Fnu4HI GCNGC 3 cut(s) 173, 292, 374
FokI GGATG 1 cut(s) 233
Fsp4HI GCNGC 3 cut(s) 173, 292, 374
FspBI CTAG 2 cut(s) 122, 359
GlaI GCGC 1 cut(s) 387
GluI GCNGC 3 cut(s) 173, 292, 374
HaeIII GGCC 1 cut(s) 68
HapII CCGG 1 cut(s) 244
HgaI GACGC 1 cut(s) 313
HhaI GCGC 1 cut(s) 388
Hin1I GRCGYC 2 cut(s) 305, 352
Hin1II CATG 3 cut(s) 172, 304, 426
Hin6I GCGC 1 cut(s) 386
HinP1I GCGC 1 cut(s) 386
HincII GTYRAC 1 cut(s) 394
HindII GTYRAC 1 cut(s) 394
HinfI GANTC 3 cut(s) 10, 178, 341
HpaII CCGG 1 cut(s) 244
Hpy166II GTNNAC 2 cut(s) 131, 394
Hpy188I TCNGA 4 cut(s) 15, 26, 104, 210
Hpy188III TCNNGA 2 cut(s) 122, 403
Hpy8I GTNNAC 2 cut(s) 131, 394
HpyCH4IV ACGT 1 cut(s) 352
HpyCH4V TGCA 6 cut(s) 163, 172, 276, 294, 300, 376
HpyF10VI GCNNNNNNNGC 4 cut(s) 169, 282, 291, 297
HpyF3I CTNAG 5 cut(s) 71, 101, 257, 347, 368
HpySE526I ACGT 1 cut(s) 352
Hsp92I GRCGYC 2 cut(s) 305, 352
Hsp92II CATG 3 cut(s) 172, 304, 426
HspAI GCGC 1 cut(s) 386
Kzo9I GATC 1 cut(s) 141
LmnI GCTCC 1 cut(s) 29
LpnPI CCDG 9 cut(s) 67, 94, 257, 265, 294, 321, 335, 383, 410
Lsp1109I GCAGC 3 cut(s) 184, 278, 360
LweI GCATC 1 cut(s) 285
MabI ACCWGGT 1 cut(s) 396
MaeI CTAG 2 cut(s) 122, 359
MaeII ACGT 1 cut(s) 352
MalI GATC 1 cut(s) 143
MboI GATC 1 cut(s) 141
MhlI GDGCHC 2 cut(s) 34, 237
MluCI AATT 1 cut(s) 113
MlyI GAGTC 1 cut(s) 4
MnlI CCTC 6 cut(s) 20, 110, 204, 217, 266, 363
MseI TTAA 2 cut(s) 60, 90
MspA1I CMGCKG 1 cut(s) 175
MspI CCGG 1 cut(s) 244
MspR9I CCNGG 3 cut(s) 82, 309, 398
MvaI CCWGG 3 cut(s) 82, 309, 398
MwoI GCNNNNNNNGC 4 cut(s) 169, 282, 291, 297
NdeII GATC 1 cut(s) 141
NlaIII CATG 3 cut(s) 172, 304, 426
NspI RCATGY 2 cut(s) 172, 426
PciI ACATGT 1 cut(s) 422
PfeI GAWTC 2 cut(s) 178, 341
PinAI ACCGGT 1 cut(s) 243
PkrI GCNGC 3 cut(s) 174, 293, 375
PleI GAGTC 1 cut(s) 4
PpsI GAGTC 1 cut(s) 4
PscI ACATGT 1 cut(s) 422
Psp6I CCWGG 3 cut(s) 80, 307, 396
PspGI CCWGG 3 cut(s) 80, 307, 396
PspPI GGNCC 2 cut(s) 67, 319
PstI CTGCAG 1 cut(s) 378
PvuII CAGCTG 1 cut(s) 175
SaqAI TTAA 2 cut(s) 60, 90
SatI GCNGC 3 cut(s) 173, 292, 374
Sau3AI GATC 1 cut(s) 141
Sau96I GGNCC 2 cut(s) 67, 319
SchI GAGTC 1 cut(s) 4
ScrFI CCNGG 3 cut(s) 82, 309, 398
SduI GDGCHC 2 cut(s) 34, 237
SetI ASST 6 cut(s) 37, 102, 177, 327, 355, 402
SexAI ACCWGGT 1 cut(s) 396
SfaNI GCATC 1 cut(s) 285
SfcI CTRYAG 1 cut(s) 374
SinI GGWCC 1 cut(s) 319
Sse9I AATT 1 cut(s) 113
SsiI CCGC 1 cut(s) 317
SspMI CTAG 2 cut(s) 122, 359
StyD4I CCNGG 3 cut(s) 80, 307, 396
TaiI ACGT 1 cut(s) 355
TaqI TCGA 2 cut(s) 147, 251
TasI AATT 1 cut(s) 113
TfiI GAWTC 2 cut(s) 178, 341
Tru1I TTAA 2 cut(s) 60, 90
Tru9I TTAA 2 cut(s) 60, 90
TseI GCWGC 3 cut(s) 172, 291, 373
VpaK11BI GGWCC 1 cut(s) 319
XapI RAATTY 1 cut(s) 113
XbaI TCTAGA 1 cut(s) 121
XceI RCATGY 2 cut(s) 172, 426
XspI CTAG 2 cut(s) 122, 359
ZraI GACGTC 1 cut(s) 353
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.