Rroxscaffold_1G00022150

ribonuclease H protein At1g65750-like

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
27267087 .. 27267385
299 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00022150.1

Sequence Viewer

Length: 204 bp
ATGGATGTGCAAGTGAACAAAGTTACAAAGATGACCCCACCAAAAGTCAAATGGAGTCCACCTACTGCACCAAATCTTAAGCTCAATGTAGATGCAGCAATTGATGTCAACAAGAAGAAGTCAAGTTTGGGTATGCTTGTACGCGATGGAGAAGGGGAATTTGAAGCTATACTCAGATTGAAGTGGAAAGAGTCGAAAGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

67

Amino Acids

7.54

Weight (kDa)

9.57

Isoelectric Point (pI)

34.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 144
AcsI RAATTY 1 cut(s) 158
AfaI GTAC 1 cut(s) 141
AflII CTTAAG 1 cut(s) 77
AgsI TTSAA 2 cut(s) 164, 181
AjuI GAANNNNNNNTTGG 2 cut(s) 110, 142
AluBI AGCT 2 cut(s) 82, 167
AluI AGCT 2 cut(s) 82, 167
ApeKI GCWGC 1 cut(s) 95
ApoI RAATTY 1 cut(s) 158
BbvI GCAGC 1 cut(s) 107
BccI CCATC 1 cut(s) 140
BfrI CTTAAG 1 cut(s) 77
BisI GCNGC 1 cut(s) 96
BlsI GCNGC 1 cut(s) 97
BmsI GCATC 1 cut(s) 82
BseGI GGATG 1 cut(s) 10
BseMII CTCAG 1 cut(s) 187
BseXI GCAGC 1 cut(s) 107
BsgI GTGCAG 1 cut(s) 51
Bsh1236I CGCG 1 cut(s) 144
BspCNI CTCAG 1 cut(s) 186
BspFNI CGCG 1 cut(s) 144
BspTI CTTAAG 1 cut(s) 77
BstAFI CTTAAG 1 cut(s) 77
BstDEI CTNAG 1 cut(s) 173
BstF5I GGATG 1 cut(s) 10
BstFNI CGCG 1 cut(s) 144
BstUI CGCG 1 cut(s) 144
BstV1I GCAGC 1 cut(s) 107
BtgZI GCGATG 1 cut(s) 159
BtsCI GGATG 1 cut(s) 10
Csp6I GTAC 1 cut(s) 140
CviJI RGCY 2 cut(s) 82, 167
CviKI_1 RGCY 2 cut(s) 82, 167
CviQI GTAC 1 cut(s) 140
DdeI CTNAG 1 cut(s) 173
FaiI YATR 2 cut(s) 134, 170
Fnu4HI GCNGC 1 cut(s) 96
FokI GGATG 1 cut(s) 17
Fsp4HI GCNGC 1 cut(s) 96
GluI GCNGC 1 cut(s) 96
HincII GTYRAC 1 cut(s) 109
HindII GTYRAC 1 cut(s) 109
HinfI GANTC 2 cut(s) 55, 191
Hpy166II GTNNAC 3 cut(s) 16, 59, 109
Hpy188I TCNGA 1 cut(s) 176
Hpy8I GTNNAC 3 cut(s) 16, 59, 109
HpyAV CCTTC 1 cut(s) 146
HpyCH4V TGCA 3 cut(s) 10, 68, 95
HpyF3I CTNAG 1 cut(s) 173
Lsp1109I GCAGC 1 cut(s) 107
LweI GCATC 1 cut(s) 82
MaeIII GTNAC 1 cut(s) 22
MboII GAAGA 1 cut(s) 127
MfeI CAATTG 1 cut(s) 99
MluCI AATT 2 cut(s) 99, 158
MlyI GAGTC 2 cut(s) 64, 200
MseI TTAA 1 cut(s) 78
MspCI CTTAAG 1 cut(s) 77
MunI CAATTG 1 cut(s) 99
MvnI CGCG 1 cut(s) 144
PkrI GCNGC 1 cut(s) 97
PleI GAGTC 2 cut(s) 63, 199
PpsI GAGTC 2 cut(s) 63, 199
RsaI GTAC 1 cut(s) 141
RsaNI GTAC 1 cut(s) 140
SaqAI TTAA 1 cut(s) 78
SatI GCNGC 1 cut(s) 96
SchI GAGTC 2 cut(s) 64, 200
SetI ASST 3 cut(s) 64, 84, 169
SfaNI GCATC 1 cut(s) 82
SgeI CNNG 5 cut(s) 23, 124, 135, 149, 155
SmlI CTYRAG 1 cut(s) 77
SmoI CTYRAG 1 cut(s) 77
Sse9I AATT 2 cut(s) 99, 158
TaqI TCGA 1 cut(s) 194
TasI AATT 2 cut(s) 99, 158
Tru1I TTAA 1 cut(s) 78
Tru9I TTAA 1 cut(s) 78
TseI GCWGC 1 cut(s) 95
Vha464I CTTAAG 1 cut(s) 77
XapI RAATTY 1 cut(s) 158
XcmI CCANNNNNNNNNTGG 1 cut(s) 48
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.