Rroxscaffold_4G00328560

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Reverse (-)
61595374 .. 61596193
820 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00328560.1

Sequence Viewer

Length: 432 bp
ATGTCGCTTACTTTGACAACTCGCAGTTGGTCGAATGCACAATTGCGGGTATCATCTAACCAAGAGCTTACTTTTGTCCTAAATCCTAATAGCTCCATCTTGCTGCCGATTCTACACCAAGGTGAAAGCTTCTACGGCATCGAATCTGAAATTTCGGAAGAAGCTTATAGAAGCCATGTAGCAAACCCACTAAGCACCGATGACAAGTGGATTCCACCGAAGCCTCCCTTCCTCAAACAAAATGTTGATGCTGCAATTGACCATAAGAGGAGTAAAGTTGGGTTGGGTGGAGTGGTCGGAGATGAGAATGGAAGAGTTAAAGGGGCATTTATGCATAATATGTTGGGATGCCTTTCAGCCCACTCTAGTGAAGCCTTAGCTGTTCTATTTGGTATGAGGTTTTGCTTGATGGAAGAGTTTAAGCTGAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

143

Amino Acids

15.83

Weight (kDa)

6.51

Isoelectric Point (pI)

56.32

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RVT_3 PF13456 81 - 140 2.5e-07 Reverse transcriptase-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 46
AcsI RAATTY 1 cut(s) 150
AleI CACNNNNGTG 2 cut(s) 120, 366
AluBI AGCT 6 cut(s) 67, 93, 129, 164, 380, 424
AluI AGCT 6 cut(s) 67, 93, 129, 164, 380, 424
ApeKI GCWGC 2 cut(s) 103, 251
ApoI RAATTY 1 cut(s) 150
AsuHPI GGTGA 1 cut(s) 134
BbvI GCAGC 2 cut(s) 90, 238
BccI CCATC 2 cut(s) 104, 403
BceAI ACGGC 1 cut(s) 151
BfaI CTAG 1 cut(s) 366
BisI GCNGC 2 cut(s) 104, 252
BlsI GCNGC 2 cut(s) 105, 253
BmsI GCATC 3 cut(s) 147, 238, 338
Bpu10I CCTNAGC 1 cut(s) 376
BsaJI CCNNGG 1 cut(s) 118
BseDI CCNNGG 1 cut(s) 118
BseGI GGATG 1 cut(s) 353
BseRI GAGGAG 1 cut(s) 283
BseXI GCAGC 2 cut(s) 90, 238
BsmI GAATGC 1 cut(s) 40
BspACI CCGC 1 cut(s) 46
BssECI CCNNGG 1 cut(s) 118
BssT1I CCWWGG 1 cut(s) 118
Bst6I CTCTTC 2 cut(s) 307, 408
BstDEI CTNAG 2 cut(s) 191, 376
BstF5I GGATG 1 cut(s) 353
BstMWI GCNNNNNNNGC 1 cut(s) 135
BstV1I GCAGC 2 cut(s) 90, 238
BtsCI GGATG 1 cut(s) 353
CviAII CATG 1 cut(s) 176
DdeI CTNAG 2 cut(s) 191, 376
Eam1104I CTCTTC 2 cut(s) 307, 408
EarI CTCTTC 2 cut(s) 307, 408
Eco130I CCWWGG 1 cut(s) 118
EcoT14I CCWWGG 1 cut(s) 118
EcoT22I ATGCAT 1 cut(s) 336
ErhI CCWWGG 1 cut(s) 118
FaeI CATG 1 cut(s) 179
FaiI YATR 7 cut(s) 168, 177, 264, 332, 336, 341, 395
FalI AAGNNNNNCTT 2 cut(s) 212, 244
FatI CATG 1 cut(s) 175
FauI CCCGC 1 cut(s) 39
Fnu4HI GCNGC 2 cut(s) 104, 252
FokI GGATG 1 cut(s) 360
Fsp4HI GCNGC 2 cut(s) 104, 252
FspBI CTAG 1 cut(s) 366
GluI GCNGC 2 cut(s) 104, 252
Hin1II CATG 1 cut(s) 179
HindIII AAGCTT 2 cut(s) 127, 162
HinfI GANTC 3 cut(s) 109, 143, 211
HphI GGTGA 1 cut(s) 134
Hpy188I TCNGA 3 cut(s) 148, 157, 299
HpyAV CCTTC 1 cut(s) 238
HpyCH4V TGCA 3 cut(s) 38, 254, 334
HpyF10VI GCNNNNNNNGC 1 cut(s) 135
HpyF3I CTNAG 2 cut(s) 191, 376
Hsp92II CATG 1 cut(s) 179
LmnI GCTCC 1 cut(s) 98
Lsp1109I GCAGC 2 cut(s) 90, 238
LweI GCATC 3 cut(s) 147, 238, 338
MaeI CTAG 1 cut(s) 366
MboII GAAGA 3 cut(s) 170, 324, 425
MfeI CAATTG 2 cut(s) 41, 255
MluCI AATT 3 cut(s) 41, 150, 255
MmeI TCCRAC 1 cut(s) 277
MnlI CCTC 4 cut(s) 234, 242, 261, 390
Mph1103I ATGCAT 1 cut(s) 336
MseI TTAA 2 cut(s) 318, 420
MslI CAYNNNNRTG 2 cut(s) 120, 366
MunI CAATTG 2 cut(s) 41, 255
Mva1269I GAATGC 1 cut(s) 40
MwoI GCNNNNNNNGC 1 cut(s) 135
NlaIII CATG 1 cut(s) 179
NsiI ATGCAT 1 cut(s) 336
OliI CACNNNNGTG 2 cut(s) 120, 366
PctI GAATGC 1 cut(s) 40
PfeI GAWTC 3 cut(s) 109, 143, 211
PkrI GCNGC 2 cut(s) 105, 253
RseI CAYNNNNRTG 2 cut(s) 120, 366
SaqAI TTAA 2 cut(s) 318, 420
SatI GCNGC 2 cut(s) 104, 252
SetI ASST 8 cut(s) 69, 95, 124, 131, 166, 382, 401, 426
SfaNI GCATC 3 cut(s) 147, 238, 338
SgeI CNNG 9 cut(s) 33, 59, 74, 112, 131, 188, 217, 378, 418
SmiMI CAYNNNNRTG 2 cut(s) 120, 366
Sse9I AATT 3 cut(s) 41, 150, 255
SsiI CCGC 1 cut(s) 46
SspMI CTAG 1 cut(s) 366
StyI CCWWGG 1 cut(s) 118
TaqI TCGA 2 cut(s) 32, 141
TasI AATT 3 cut(s) 41, 150, 255
TfiI GAWTC 3 cut(s) 109, 143, 211
Tru1I TTAA 2 cut(s) 318, 420
Tru9I TTAA 2 cut(s) 318, 420
TseI GCWGC 2 cut(s) 103, 251
XapI RAATTY 1 cut(s) 150
XspI CTAG 1 cut(s) 366
Zsp2I ATGCAT 1 cut(s) 336
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.