Rmu_sc0007029.1_g000018

Ubiquitin exists either covalently attached to another protein, or free (unanchored). When covalently bound, it is conjugated to target proteins via an isopeptide bond either as a monomer (monoubiquitin), a polymer linked via different Lys residues of the ubiquitin (polyubiquitin chains) or a linear polymer linked via the initiator Met of the ubiquitin (linear polyubiquitin chains). Polyubiquitin chains, when attached to a target protein, have different functions depending on the Lys residue of the ubiquitin that is linked

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007029.1
OG0005522
Physical Location & Seq
Reverse (-)
82637 .. 83176
540 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007029.1_g000018.1.cds

Sequence Viewer

Length: 540 bp
atgaccacgaaaccctttcggcttccgacctcgaaagctggtccgttgcctgtgccattttctgccccgggggagatcatttgtcccaaaatggatgctgcccacatgtttgtgaaaatgcctaagtgggccgaacaagtgccgatggaggtgcagccgtcgtatattgggagagaaatcaaggcggtgatggagagtgctacggggatgtttattgacaagtatgtggtaagtcatggaggtaagatcatagacgattccgtgaggttttgtaattgtgatgtgaataaggaaatgccgatttatttactgtcgagggggaagaaattttgggttgttgcgaaaggttgtgggtgggaagaattgattatggtgtgtgaatcatatactgtgggggatgtaaagaagatggttgagaattttgcccaggtgaagagtgaaggacgggtgctttttcgggccggaaatgatatggtttgtcttgatgatgatgggaagccccttgtgttttacgatgtagtagagaaatctacgatttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03320 map03320
Pfam Domains
Protein Families
Motile_Sperm Pkinase ubiquitin

Protein Analysis

179

Amino Acids

20.04

Weight (kDa)

6.73

Isoelectric Point (pI)

38.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 185
AcsI RAATTY 2 cut(s) 326, 418
AflIII ACRYGT 1 cut(s) 105
AjnI CCWGG 1 cut(s) 426
AluBI AGCT 1 cut(s) 38
AluI AGCT 1 cut(s) 38
Ama87I CYCGRG 1 cut(s) 67
AoxI GGCC 2 cut(s) 129, 459
ApeKI GCWGC 2 cut(s) 98, 154
ApoI RAATTY 2 cut(s) 326, 418
AspS9I GGNCC 3 cut(s) 41, 129, 459
AsuC2I CCSGG 2 cut(s) 68, 69
AsuHPI GGTGA 2 cut(s) 199, 442
AvaI CYCGRG 1 cut(s) 67
AvaII GGWCC 1 cut(s) 41
BbvI GCAGC 2 cut(s) 85, 166
BccI CCATC 4 cut(s) 139, 184, 403, 485
BceAI ACGGC 1 cut(s) 142
BcgI CGANNNNNNTGC 2 cut(s) 133, 167
BciT130I CCWGG 1 cut(s) 428
BcnI CCSGG 2 cut(s) 68, 69
BisI GCNGC 2 cut(s) 99, 155
BlsI GCNGC 2 cut(s) 100, 156
Bme1390I CCNGG 3 cut(s) 68, 69, 428
Bme18I GGWCC 1 cut(s) 41
BmeT110I CYCGRG 1 cut(s) 67
BmgT120I GGNCC 3 cut(s) 41, 129, 459
BmrFI CCNGG 3 cut(s) 68, 69, 428
BmsI GCATC 1 cut(s) 85
BpuMI CCSGG 2 cut(s) 68, 69
BsaJI CCNNGG 4 cut(s) 66, 67, 68, 426
BseBI CCWGG 1 cut(s) 428
BseDI CCNNGG 4 cut(s) 66, 67, 68, 426
BseGI GGATG 3 cut(s) 100, 213, 403
BseXI GCAGC 2 cut(s) 85, 166
BsgI GTGCAG 1 cut(s) 173
BshFI GGCC 2 cut(s) 131, 461
BsiHKCI CYCGRG 1 cut(s) 67
BsiSI CCGG 2 cut(s) 68, 462
BslFI GGGAC 1 cut(s) 69
BsmFI GGGAC 1 cut(s) 69
BsnI GGCC 2 cut(s) 131, 461
BsoBI CYCGRG 1 cut(s) 67
Bsp143I GATC 2 cut(s) 75, 246
BspACI CCGC 1 cut(s) 185
BspANI GGCC 2 cut(s) 131, 461
BssECI CCNNGG 4 cut(s) 66, 67, 68, 426
BssMI GATC 2 cut(s) 75, 246
Bst2UI CCWGG 1 cut(s) 428
Bst4CI ACNGT 2 cut(s) 312, 391
Bst6I CTCTTC 1 cut(s) 428
BstDEI CTNAG 1 cut(s) 123
BstF5I GGATG 3 cut(s) 100, 213, 403
BstKTI GATC 2 cut(s) 78, 249
BstMBI GATC 2 cut(s) 75, 246
BstNI CCWGG 1 cut(s) 428
BstNSI RCATGY 1 cut(s) 109
BstSCI CCNGG 3 cut(s) 66, 67, 426
BstV1I GCAGC 2 cut(s) 85, 166
BsuRI GGCC 2 cut(s) 131, 461
BtsCI GGATG 3 cut(s) 100, 213, 403
Cfr13I GGNCC 3 cut(s) 41, 129, 459
Cfr9I CCCGGG 1 cut(s) 67
CviAII CATG 2 cut(s) 106, 236
CviJI RGCY 6 cut(s) 22, 38, 131, 157, 461, 499
CviKI_1 RGCY 6 cut(s) 22, 38, 131, 157, 461, 499
DdeI CTNAG 1 cut(s) 123
DpnI GATC 2 cut(s) 77, 248
DpnII GATC 2 cut(s) 75, 246
Eam1104I CTCTTC 1 cut(s) 428
EarI CTCTTC 1 cut(s) 428
Eco47I GGWCC 1 cut(s) 41
Eco88I CYCGRG 1 cut(s) 67
EcoRII CCWGG 1 cut(s) 426
FaeI CATG 2 cut(s) 109, 239
FaiI YATR 9 cut(s) 107, 165, 225, 237, 251, 371, 385, 387, 473
FaqI GGGAC 1 cut(s) 69
FatI CATG 2 cut(s) 105, 235
Fnu4HI GCNGC 2 cut(s) 99, 155
FokI GGATG 3 cut(s) 107, 220, 410
Fsp4HI GCNGC 2 cut(s) 99, 155
GluI GCNGC 2 cut(s) 99, 155
HaeIII GGCC 2 cut(s) 131, 461
HapII CCGG 2 cut(s) 68, 462
Hin1II CATG 2 cut(s) 109, 239
HinfI GANTC 2 cut(s) 257, 380
HpaII CCGG 2 cut(s) 68, 462
HphI GGTGA 2 cut(s) 199, 442
Hpy188I TCNGA 1 cut(s) 27
Hpy188III TCNNGA 1 cut(s) 482
Hpy99I CGWCG 1 cut(s) 163
HpyAV CCTTC 1 cut(s) 434
HpyCH4III ACNGT 2 cut(s) 312, 391
HpyCH4V TGCA 1 cut(s) 154
HpyF3I CTNAG 1 cut(s) 123
Hsp92II CATG 2 cut(s) 109, 239
Kzo9I GATC 2 cut(s) 75, 246
LpnPI CCDG 6 cut(s) 24, 63, 81, 413, 440, 475
Lsp1109I GCAGC 2 cut(s) 85, 166
LweI GCATC 1 cut(s) 85
MalI GATC 2 cut(s) 77, 248
MboI GATC 2 cut(s) 75, 246
MboII GAAGA 4 cut(s) 334, 371, 418, 445
MluCI AATT 4 cut(s) 274, 326, 362, 418
MmeI TCCRAC 1 cut(s) 50
MnlI CCTC 5 cut(s) 40, 142, 233, 258, 309
MslI CAYNNNNRTG 1 cut(s) 110
MspI CCGG 2 cut(s) 68, 462
MspR9I CCNGG 3 cut(s) 68, 69, 428
MvaI CCWGG 1 cut(s) 428
NciI CCSGG 2 cut(s) 68, 69
NdeII GATC 2 cut(s) 75, 246
NlaIII CATG 2 cut(s) 109, 239
NspI RCATGY 1 cut(s) 109
PciI ACATGT 1 cut(s) 105
PfeI GAWTC 2 cut(s) 257, 380
PkrI GCNGC 2 cut(s) 100, 156
PscI ACATGT 1 cut(s) 105
Psp6I CCWGG 1 cut(s) 426
PspGI CCWGG 1 cut(s) 426
PspPI GGNCC 3 cut(s) 41, 129, 459
RseI CAYNNNNRTG 1 cut(s) 110
SatI GCNGC 2 cut(s) 99, 155
Sau3AI GATC 2 cut(s) 75, 246
Sau96I GGNCC 3 cut(s) 41, 129, 459
ScrFI CCNGG 3 cut(s) 68, 69, 428
SetI ASST 7 cut(s) 32, 40, 153, 244, 269, 349, 432
SfaNI GCATC 1 cut(s) 85
SinI GGWCC 1 cut(s) 41
SmaI CCCGGG 1 cut(s) 69
SmiMI CAYNNNNRTG 1 cut(s) 110
Sse9I AATT 4 cut(s) 274, 326, 362, 418
SsiI CCGC 1 cut(s) 185
StyD4I CCNGG 3 cut(s) 66, 67, 426
TaaI ACNGT 2 cut(s) 312, 391
TaqI TCGA 2 cut(s) 32, 314
TasI AATT 4 cut(s) 274, 326, 362, 418
TfiI GAWTC 2 cut(s) 257, 380
TseI GCWGC 2 cut(s) 98, 154
TspGWI ACGGA 2 cut(s) 33, 250
TspMI CCCGGG 1 cut(s) 67
VpaK11BI GGWCC 1 cut(s) 41
XapI RAATTY 2 cut(s) 326, 418
XceI RCATGY 1 cut(s) 109
XmaI CCCGGG 1 cut(s) 67
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.