Rh6CG313500

Ubiquitin exists either covalently attached to another protein, or free (unanchored). When covalently bound, it is conjugated to target proteins via an isopeptide bond either as a monomer (monoubiquitin), a polymer linked via different Lys residues of the ubiquitin (polyubiquitin chains) or a linear polymer linked via the initiator Met of the ubiquitin (linear polyubiquitin chains). Polyubiquitin chains, when attached to a target protein, have different functions depending on the Lys residue of the ubiquitin that is linked

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
Physical Location & Seq
Forward (+)
49834692 .. 49835030
339 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG313500.1

Sequence Viewer

Length: 339 bp
ATGTTCATTGAGACTCCAAACCATAAGAAGGTTGTAATCAAACCTAGCAGTAGAAATGCAGTTCATAACATTTTGTACATGATTCCCAAACAAGCCCTCGACAAAATCAATTGGAAGCCAAGGCTCTTCCTTGATGGTAATGTTCTCCCAGAGCACAAAACCCTGGCTCAGTTGGGTGTTCAGTCAGGTGTGGTTTTATGGTTGGACCGTCTTGTGCAGATTGATGTCACCAGGCCAAATGGTGCAACCATTCATGTGAATATGAACCTTTCTTACAAAATCAAAGCTATCAAGGAGAAAATTGAACAAGAATGTGGTATCCCTATAGGACTACAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

112

Amino Acids

12.72

Weight (kDa)

9.67

Isoelectric Point (pI)

50.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 77
AfiI CCNNNNNNNGG 1 cut(s) 28
AgsI TTSAA 1 cut(s) 305
AjnI CCWGG 2 cut(s) 162, 230
AluBI AGCT 1 cut(s) 287
AluI AGCT 1 cut(s) 287
Alw21I GWGCWC 1 cut(s) 156
Alw26I GTCTC 1 cut(s) 5
AoxI GGCC 1 cut(s) 233
AspS9I GGNCC 1 cut(s) 205
AsuHPI GGTGA 1 cut(s) 220
AvaII GGWCC 1 cut(s) 205
Bbv12I GWGCWC 1 cut(s) 156
BccI CCATC 1 cut(s) 128
BciT130I CCWGG 2 cut(s) 164, 232
BciVI GTATCC 1 cut(s) 329
BcoDI GTCTC 1 cut(s) 5
BfaI CTAG 1 cut(s) 45
BfmI CTRYAG 1 cut(s) 324
BfuI GTATCC 1 cut(s) 329
Bme1390I CCNGG 2 cut(s) 164, 232
Bme18I GGWCC 1 cut(s) 205
BmgT120I GGNCC 1 cut(s) 205
BmrFI CCNGG 2 cut(s) 164, 232
BsaJI CCNNGG 2 cut(s) 119, 162
Bsc4I CCNNNNNNNGG 1 cut(s) 28
BseBI CCWGG 2 cut(s) 164, 232
BseDI CCNNGG 2 cut(s) 119, 162
BseLI CCNNNNNNNGG 1 cut(s) 28
BseMII CTCAG 1 cut(s) 182
BsgI GTGCAG 1 cut(s) 236
BshFI GGCC 1 cut(s) 235
BsiHKAI GWGCWC 1 cut(s) 156
BslI CCNNNNNNNGG 1 cut(s) 28
BsmAI GTCTC 1 cut(s) 5
BsnI GGCC 1 cut(s) 235
Bsp1286I GDGCHC 1 cut(s) 156
Bsp1407I TGTACA 1 cut(s) 75
BspANI GGCC 1 cut(s) 235
BspCNI CTCAG 1 cut(s) 181
BspQI GCTCTTC 1 cut(s) 131
BsrGI TGTACA 1 cut(s) 75
BssECI CCNNGG 2 cut(s) 119, 162
BssT1I CCWWGG 1 cut(s) 119
Bst2UI CCWGG 2 cut(s) 164, 232
Bst4CI ACNGT 1 cut(s) 209
Bst6I CTCTTC 1 cut(s) 131
BstAUI TGTACA 1 cut(s) 75
BstDEI CTNAG 1 cut(s) 168
BstMAI GTCTC 1 cut(s) 5
BstNI CCWGG 2 cut(s) 164, 232
BstSCI CCNGG 2 cut(s) 162, 230
BstSFI CTRYAG 1 cut(s) 324
BsuI GTATCC 1 cut(s) 329
BsuRI GGCC 1 cut(s) 235
Cfr13I GGNCC 1 cut(s) 205
Csp6I GTAC 1 cut(s) 76
CviAII CATG 2 cut(s) 79, 254
CviJI RGCY 6 cut(s) 95, 118, 124, 167, 235, 287
CviKI_1 RGCY 6 cut(s) 95, 118, 124, 167, 235, 287
CviQI GTAC 1 cut(s) 76
DdeI CTNAG 1 cut(s) 168
Eam1104I CTCTTC 1 cut(s) 131
EarI CTCTTC 1 cut(s) 131
Eco130I CCWWGG 1 cut(s) 119
Eco47I GGWCC 1 cut(s) 205
EcoRII CCWGG 2 cut(s) 162, 230
EcoT14I CCWWGG 1 cut(s) 119
ErhI CCWWGG 1 cut(s) 119
FaeI CATG 2 cut(s) 82, 257
FaiI YATR 7 cut(s) 24, 66, 80, 199, 255, 263, 326
FatI CATG 2 cut(s) 78, 253
FspBI CTAG 1 cut(s) 45
HaeIII GGCC 1 cut(s) 235
Hin1II CATG 2 cut(s) 82, 257
HinfI GANTC 2 cut(s) 13, 82
HphI GGTGA 1 cut(s) 220
HpyAV CCTTC 1 cut(s) 22
HpyCH4III ACNGT 1 cut(s) 209
HpyCH4V TGCA 3 cut(s) 59, 217, 245
HpyF3I CTNAG 1 cut(s) 168
Hsp92II CATG 2 cut(s) 82, 257
LguI GCTCTTC 1 cut(s) 131
LpnPI CCDG 6 cut(s) 149, 162, 171, 176, 217, 244
MaeI CTAG 1 cut(s) 45
MaeIII GTNAC 1 cut(s) 226
MboII GAAGA 1 cut(s) 118
MfeI CAATTG 1 cut(s) 109
MhlI GDGCHC 1 cut(s) 156
MluCI AATT 2 cut(s) 109, 300
MlyI GAGTC 1 cut(s) 7
MmeI TCCRAC 1 cut(s) 183
MnlI CCTC 1 cut(s) 107
MslI CAYNNNNRTG 1 cut(s) 254
MspR9I CCNGG 2 cut(s) 164, 232
MunI CAATTG 1 cut(s) 109
MvaI CCWGG 2 cut(s) 164, 232
NlaIII CATG 2 cut(s) 82, 257
NmuCI GTSAC 1 cut(s) 226
PciSI GCTCTTC 1 cut(s) 131
PfeI GAWTC 1 cut(s) 82
PleI GAGTC 1 cut(s) 7
PpsI GAGTC 1 cut(s) 7
Psp6I CCWGG 2 cut(s) 162, 230
PspGI CCWGG 2 cut(s) 162, 230
PspPI GGNCC 1 cut(s) 205
PsrI GAACNNNNNNTAC 2 cut(s) 257, 289
RsaI GTAC 1 cut(s) 77
RsaNI GTAC 1 cut(s) 76
RseI CAYNNNNRTG 1 cut(s) 254
SapI GCTCTTC 1 cut(s) 131
Sau96I GGNCC 1 cut(s) 205
SchI GAGTC 1 cut(s) 7
ScrFI CCNGG 2 cut(s) 164, 232
SduI GDGCHC 1 cut(s) 156
SetI ASST 5 cut(s) 33, 46, 190, 270, 289
SfcI CTRYAG 1 cut(s) 324
SinI GGWCC 1 cut(s) 205
SmiMI CAYNNNNRTG 1 cut(s) 254
Sse9I AATT 2 cut(s) 109, 300
SspMI CTAG 1 cut(s) 45
StyD4I CCNGG 2 cut(s) 162, 230
StyI CCWWGG 1 cut(s) 119
TaaI ACNGT 1 cut(s) 209
TaqI TCGA 1 cut(s) 99
TasI AATT 2 cut(s) 109, 300
TatI WGTACW 1 cut(s) 75
TfiI GAWTC 1 cut(s) 82
TseFI GTSAC 1 cut(s) 226
Tsp45I GTSAC 1 cut(s) 226
TspDTI ATGAA 3 cut(s) 53, 242, 278
VpaK11BI GGWCC 1 cut(s) 205
XspI CTAG 1 cut(s) 45
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.