Rh6CG313400

Ubiquitin exists either covalently attached to another protein, or free (unanchored). When covalently bound, it is conjugated to target proteins via an isopeptide bond either as a monomer (monoubiquitin), a polymer linked via different Lys residues of the ubiquitin (polyubiquitin chains) or a linear polymer linked via the initiator Met of the ubiquitin (linear polyubiquitin chains). Polyubiquitin chains, when attached to a target protein, have different functions depending on the Lys residue of the ubiquitin that is linked

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
OG0005522
Physical Location & Seq
Forward (+)
49833982 .. 49834401
420 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG313400.1

Sequence Viewer

Length: 420 bp
ATGGTGTGTGAATCATATACTGTGCTTTTTCGGGTGAAGAGTGAAGGACTGGTGCTTTTTCGGGGCGGAAATGATATGGTTTGTCTTGATGATGATGGGAAGCCCCTTGTGTTTTACGATGTAATAGAGAAATCTATGATTTGGATACTCAGTTTGGCTGTGAAATTAACCATCAAGATGCCACAGGCTAGAGATGTGGTGACCCTCAATGCTTATAGGGTCAACACCGTAAAGGACATCAAGTCTTATATATTTGAGAAGATGGGGATCCCATTTAGCAATCAGAAGCTTTTCTATAGGGGGATTTTTCTTTCTGATGAGGCTGATTCCCTAGATGGCTACAAAATGGAAGGTAATTGTGATATTTTTGCAACTTTTGGATCAGGAGATGATGATGAACAAGTTCCAAATGTTGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03320 map03320
Pfam Domains
Protein Families
Motile_Sperm Pkinase ubiquitin

Protein Analysis

139

Amino Acids

15.75

Weight (kDa)

4.6

Isoelectric Point (pI)

30.44

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ubiquitin PF00240 56 - 120 1.1e-07 Ubiquitin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 66
AclWI GGATC 3 cut(s) 262, 275, 388
AgsI TTSAA 1 cut(s) 416
AhdI GACNNNNNGTC 1 cut(s) 241
AluBI AGCT 1 cut(s) 289
AluI AGCT 1 cut(s) 289
AlwI GGATC 3 cut(s) 262, 275, 388
Asp700I GAANNNNTTC 2 cut(s) 290, 402
AsuHPI GGTGA 2 cut(s) 46, 211
BamHI GGATCC 1 cut(s) 267
BccI CCATC 4 cut(s) 89, 179, 256, 329
BciVI GTATCC 1 cut(s) 138
BfaI CTAG 2 cut(s) 189, 332
BfmI CTRYAG 1 cut(s) 295
BfuI GTATCC 1 cut(s) 138
BmeRI GACNNNNNGTC 1 cut(s) 241
BmiI GGNNCC 1 cut(s) 269
BmsI GCATC 1 cut(s) 168
BsaBI GATNNNNATC 1 cut(s) 266
Bse1I ACTGG 1 cut(s) 54
Bse8I GATNNNNATC 1 cut(s) 266
BseJI GATNNNNATC 1 cut(s) 266
BseMII CTCAG 1 cut(s) 163
BseNI ACTGG 1 cut(s) 54
Bsp143I GATC 2 cut(s) 267, 380
BspACI CCGC 1 cut(s) 66
BspCNI CTCAG 1 cut(s) 162
BspLI GGNNCC 1 cut(s) 269
BspPI GGATC 3 cut(s) 262, 275, 388
BsrI ACTGG 1 cut(s) 54
BssMI GATC 2 cut(s) 267, 380
Bst4CI ACNGT 2 cut(s) 22, 229
Bst6I CTCTTC 1 cut(s) 32
BstDEI CTNAG 1 cut(s) 149
BstEII GGTNACC 1 cut(s) 199
BstKTI GATC 2 cut(s) 270, 383
BstMBI GATC 2 cut(s) 267, 380
BstPI GGTNACC 1 cut(s) 199
BstSFI CTRYAG 1 cut(s) 295
BstX2I RGATCY 1 cut(s) 267
BstYI RGATCY 1 cut(s) 267
BsuI GTATCC 1 cut(s) 138
CviJI RGCY 6 cut(s) 103, 158, 188, 289, 323, 339
CviKI_1 RGCY 6 cut(s) 103, 158, 188, 289, 323, 339
DdeI CTNAG 1 cut(s) 149
DpnI GATC 2 cut(s) 269, 382
DpnII GATC 2 cut(s) 267, 380
DriI GACNNNNNGTC 1 cut(s) 241
Eam1104I CTCTTC 1 cut(s) 32
Eam1105I GACNNNNNGTC 1 cut(s) 241
EarI CTCTTC 1 cut(s) 32
EciI GGCGGA 1 cut(s) 81
Eco91I GGTNACC 1 cut(s) 199
EcoO65I GGTNACC 1 cut(s) 199
FaiI YATR 8 cut(s) 16, 18, 77, 137, 216, 249, 251, 297
FspBI CTAG 2 cut(s) 189, 332
HincII GTYRAC 1 cut(s) 223
HindII GTYRAC 1 cut(s) 223
HindIII AAGCTT 1 cut(s) 287
HinfI GANTC 2 cut(s) 11, 326
HphI GGTGA 2 cut(s) 46, 211
Hpy166II GTNNAC 1 cut(s) 223
Hpy188I TCNGA 2 cut(s) 285, 316
Hpy188III TCNNGA 3 cut(s) 86, 175, 384
Hpy8I GTNNAC 1 cut(s) 223
HpyAV CCTTC 2 cut(s) 38, 344
HpyCH4III ACNGT 2 cut(s) 22, 229
HpyCH4V TGCA 1 cut(s) 371
HpyF3I CTNAG 1 cut(s) 149
Kzo9I GATC 2 cut(s) 267, 380
LpnPI CCDG 3 cut(s) 35, 170, 369
LweI GCATC 1 cut(s) 168
MaeI CTAG 2 cut(s) 189, 332
MaeIII GTNAC 1 cut(s) 199
MalI GATC 2 cut(s) 269, 382
MboI GATC 2 cut(s) 267, 380
MboII GAAGA 2 cut(s) 49, 271
MflI RGATCY 1 cut(s) 267
MluCI AATT 2 cut(s) 164, 355
MnlI CCTC 2 cut(s) 215, 313
MroXI GAANNNNTTC 2 cut(s) 290, 402
MseI TTAA 1 cut(s) 167
MslI CAYNNNNRTG 1 cut(s) 176
NdeII GATC 2 cut(s) 267, 380
NlaIV GGNNCC 1 cut(s) 269
NmuCI GTSAC 1 cut(s) 199
PdmI GAANNNNTTC 2 cut(s) 290, 402
PfeI GAWTC 2 cut(s) 11, 326
PspEI GGTNACC 1 cut(s) 199
PspN4I GGNNCC 1 cut(s) 269
PsuI RGATCY 1 cut(s) 267
RseI CAYNNNNRTG 1 cut(s) 176
SaqAI TTAA 1 cut(s) 167
Sau3AI GATC 2 cut(s) 267, 380
SetI ASST 2 cut(s) 291, 355
SfaNI GCATC 1 cut(s) 168
SfcI CTRYAG 1 cut(s) 295
SmiMI CAYNNNNRTG 1 cut(s) 176
Sse9I AATT 2 cut(s) 164, 355
SsiI CCGC 1 cut(s) 66
SspMI CTAG 2 cut(s) 189, 332
TaaI ACNGT 2 cut(s) 22, 229
TasI AATT 2 cut(s) 164, 355
TfiI GAWTC 2 cut(s) 11, 326
Tru1I TTAA 1 cut(s) 167
Tru9I TTAA 1 cut(s) 167
TseFI GTSAC 1 cut(s) 199
Tsp45I GTSAC 1 cut(s) 199
TspDTI ATGAA 1 cut(s) 411
XmnI GAANNNNTTC 2 cut(s) 290, 402
XspI CTAG 2 cut(s) 189, 332
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.