Rroxscaffold_7G00181450

Ubiquitin exists either covalently attached to another protein, or free (unanchored). When covalently bound, it is conjugated to target proteins via an isopeptide bond either as a monomer (monoubiquitin), a polymer linked via different Lys residues of the ubiquitin (polyubiquitin chains) or a linear polymer linked via the initiator Met of the ubiquitin (linear polyubiquitin chains). Polyubiquitin chains, when attached to a target protein, have different functions depending on the Lys residue of the ubiquitin that is linked

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Reverse (-)
20565207 .. 20565828
622 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00181450.1

Sequence Viewer

Length: 213 bp
ATGTGGTATCTCTATTGGACTACAAAGACTTATGGTGGTGATAAACTTAATGATGATATGACTTTAGGGCAGTATGAGGAAGTTTTGGGCAATCTGTGGGCTCTAAGGTGGAAGTTTTGTCATAGTTCCTGGAGAGAAAATCCTCTTGCGAATTGGATTAATGGCAGCAACCAGCGCTTCGAATCACGCAAGATTATTCATTCTAGTGAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

70

Amino Acids

8.47

Weight (kDa)

6.72

Isoelectric Point (pI)

31.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfeI AGCGCT 1 cut(s) 176
AjnI CCWGG 1 cut(s) 128
Aor51HI AGCGCT 1 cut(s) 176
ApeKI GCWGC 1 cut(s) 165
AseI ATTAAT 1 cut(s) 159
AspLEI GCGC 1 cut(s) 177
AsuHPI GGTGA 1 cut(s) 50
AsuII TTCGAA 1 cut(s) 180
BanII GRGCYC 1 cut(s) 103
BbvI GCAGC 1 cut(s) 177
BciT130I CCWGG 1 cut(s) 130
BfaI CTAG 1 cut(s) 204
BfoI RGCGCY 1 cut(s) 178
BisI GCNGC 1 cut(s) 166
BlsI GCNGC 1 cut(s) 167
Bme1390I CCNGG 1 cut(s) 130
BmrFI CCNGG 1 cut(s) 130
BpmI CTGGAG 1 cut(s) 151
Bpu14I TTCGAA 1 cut(s) 180
BseBI CCWGG 1 cut(s) 130
BseXI GCAGC 1 cut(s) 177
Bsp119I TTCGAA 1 cut(s) 180
Bsp1286I GDGCHC 1 cut(s) 103
BspT104I TTCGAA 1 cut(s) 180
Bst2UI CCWGG 1 cut(s) 130
BstBI TTCGAA 1 cut(s) 180
BstDEI CTNAG 1 cut(s) 104
BstH2I RGCGCY 1 cut(s) 178
BstHHI GCGC 1 cut(s) 177
BstMWI GCNNNNNNNGC 1 cut(s) 174
BstNI CCWGG 1 cut(s) 130
BstSCI CCNGG 1 cut(s) 128
BstV1I GCAGC 1 cut(s) 177
CfoI GCGC 1 cut(s) 177
CviJI RGCY 1 cut(s) 101
CviKI_1 RGCY 1 cut(s) 101
DdeI CTNAG 1 cut(s) 104
Eco24I GRGCYC 1 cut(s) 103
Eco47III AGCGCT 1 cut(s) 176
EcoRII CCWGG 1 cut(s) 128
EcoT38I GRGCYC 1 cut(s) 103
FaiI YATR 4 cut(s) 33, 59, 75, 123
Fnu4HI GCNGC 1 cut(s) 166
FriOI GRGCYC 1 cut(s) 103
Fsp4HI GCNGC 1 cut(s) 166
FspBI CTAG 1 cut(s) 204
GlaI GCGC 1 cut(s) 176
GluI GCNGC 1 cut(s) 166
GsuI CTGGAG 1 cut(s) 151
HaeII RGCGCY 1 cut(s) 178
HhaI GCGC 1 cut(s) 177
Hin6I GCGC 1 cut(s) 175
HinP1I GCGC 1 cut(s) 175
HinfI GANTC 1 cut(s) 182
HphI GGTGA 1 cut(s) 50
HpyF10VI GCNNNNNNNGC 1 cut(s) 174
HpyF3I CTNAG 1 cut(s) 104
HspAI GCGC 1 cut(s) 175
LpnPI CCDG 3 cut(s) 115, 142, 185
Lsp1109I GCAGC 1 cut(s) 177
MaeI CTAG 1 cut(s) 204
MhlI GDGCHC 1 cut(s) 103
MluCI AATT 1 cut(s) 151
MnlI CCTC 2 cut(s) 70, 153
MseI TTAA 2 cut(s) 48, 159
MslI CAYNNNNRTG 1 cut(s) 204
MspR9I CCNGG 1 cut(s) 130
MvaI CCWGG 1 cut(s) 130
MwoI GCNNNNNNNGC 1 cut(s) 174
NspV TTCGAA 1 cut(s) 180
PfeI GAWTC 1 cut(s) 182
PfoI TCCNGGA 1 cut(s) 128
PkrI GCNGC 1 cut(s) 167
PshBI ATTAAT 1 cut(s) 159
Psp6I CCWGG 1 cut(s) 128
PspGI CCWGG 1 cut(s) 128
RseI CAYNNNNRTG 1 cut(s) 204
SaqAI TTAA 2 cut(s) 48, 159
SatI GCNGC 1 cut(s) 166
ScrFI CCNGG 1 cut(s) 130
SduI GDGCHC 1 cut(s) 103
SetI ASST 1 cut(s) 110
SfuI TTCGAA 1 cut(s) 180
SgeI CNNG 6 cut(s) 141, 142, 158, 184, 198, 202
SmiMI CAYNNNNRTG 1 cut(s) 204
Sse9I AATT 1 cut(s) 151
SspMI CTAG 1 cut(s) 204
StyD4I CCNGG 1 cut(s) 128
TaqI TCGA 1 cut(s) 180
TasI AATT 1 cut(s) 151
TfiI GAWTC 1 cut(s) 182
Tru1I TTAA 2 cut(s) 48, 159
Tru9I TTAA 2 cut(s) 48, 159
TseI GCWGC 1 cut(s) 165
TspDTI ATGAA 1 cut(s) 188
VspI ATTAAT 1 cut(s) 159
XspI CTAG 1 cut(s) 204
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.