Rh6BG304900

Ubiquitin exists either covalently attached to another protein, or free (unanchored). When covalently bound, it is conjugated to target proteins via an isopeptide bond either as a monomer (monoubiquitin), a polymer linked via different Lys residues of the ubiquitin (polyubiquitin chains) or a linear polymer linked via the initiator Met of the ubiquitin (linear polyubiquitin chains). Polyubiquitin chains, when attached to a target protein, have different functions depending on the Lys residue of the ubiquitin that is linked

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
Physical Location & Seq
Forward (+)
53492458 .. 53492778
321 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG304900.1

Sequence Viewer

Length: 321 bp
ATGGAGGTGCAGCCGTCGTATATCGGGAGAGAAATCAAGGCGGTGATGGAGAGTGCTACAGGGATGTTTGTTGACGAGTATATGGTGAGTCATGGAGGTAAGATCATAGACGATTTTGTGAGGTTTTGTAATTGTGTTGTGAATAAGGAAATGCTTATTTATTTACTATCGAGAGGGAAGAAATTTCGGGTTGTTGCGAAAGGTTGTGGGTGGGAAGAATTGATTATGGTGTGTGAATCATATACTGTGGGGGATGTAAAGAAGATGGTTGAGAATTTTGCCCAGGTGAAGAGTGAAGGACTGGTGCTTTTTCGAGGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

106

Amino Acids

12.01

Weight (kDa)

6.57

Isoelectric Point (pI)

22.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 41
AcsI RAATTY 2 cut(s) 182, 274
AjnI CCWGG 1 cut(s) 282
ApeKI GCWGC 1 cut(s) 10
ApoI RAATTY 2 cut(s) 182, 274
AsuHPI GGTGA 3 cut(s) 55, 97, 298
BbvI GCAGC 1 cut(s) 22
BccI CCATC 2 cut(s) 40, 259
BciT130I CCWGG 1 cut(s) 284
BfmI CTRYAG 1 cut(s) 57
BisI GCNGC 1 cut(s) 11
BlsI GCNGC 1 cut(s) 12
Bme1390I CCNGG 1 cut(s) 284
BmrFI CCNGG 1 cut(s) 284
BsaJI CCNNGG 1 cut(s) 282
Bse1I ACTGG 1 cut(s) 306
BseBI CCWGG 1 cut(s) 284
BseDI CCNNGG 1 cut(s) 282
BseGI GGATG 2 cut(s) 69, 259
BseNI ACTGG 1 cut(s) 306
BseXI GCAGC 1 cut(s) 22
BsgI GTGCAG 1 cut(s) 29
Bsp143I GATC 1 cut(s) 102
BspACI CCGC 1 cut(s) 41
BsrI ACTGG 1 cut(s) 306
BssECI CCNNGG 1 cut(s) 282
BssMI GATC 1 cut(s) 102
Bst2UI CCWGG 1 cut(s) 284
Bst4CI ACNGT 1 cut(s) 247
Bst6I CTCTTC 1 cut(s) 284
BstF5I GGATG 2 cut(s) 69, 259
BstKTI GATC 1 cut(s) 105
BstMBI GATC 1 cut(s) 102
BstNI CCWGG 1 cut(s) 284
BstSCI CCNGG 1 cut(s) 282
BstSFI CTRYAG 1 cut(s) 57
BstV1I GCAGC 1 cut(s) 22
BtsCI GGATG 2 cut(s) 69, 259
CviAII CATG 1 cut(s) 92
CviJI RGCY 2 cut(s) 13, 318
CviKI_1 RGCY 2 cut(s) 13, 318
DpnI GATC 1 cut(s) 104
DpnII GATC 1 cut(s) 102
Eam1104I CTCTTC 1 cut(s) 284
EarI CTCTTC 1 cut(s) 284
EcoRII CCWGG 1 cut(s) 282
FaeI CATG 1 cut(s) 95
FaiI YATR 8 cut(s) 21, 81, 83, 93, 107, 227, 241, 243
FatI CATG 1 cut(s) 91
Fnu4HI GCNGC 1 cut(s) 11
FokI GGATG 2 cut(s) 76, 266
Fsp4HI GCNGC 1 cut(s) 11
GluI GCNGC 1 cut(s) 11
Hin1II CATG 1 cut(s) 95
HincII GTYRAC 1 cut(s) 73
HindII GTYRAC 1 cut(s) 73
HinfI GANTC 2 cut(s) 88, 236
HphI GGTGA 3 cut(s) 55, 97, 298
Hpy166II GTNNAC 1 cut(s) 73
Hpy188III TCNNGA 2 cut(s) 25, 171
Hpy8I GTNNAC 1 cut(s) 73
Hpy99I CGWCG 1 cut(s) 19
HpyAV CCTTC 1 cut(s) 290
HpyCH4III ACNGT 1 cut(s) 247
HpyCH4V TGCA 1 cut(s) 10
Hsp92II CATG 1 cut(s) 95
Kzo9I GATC 1 cut(s) 102
LpnPI CCDG 4 cut(s) 45, 269, 287, 296
Lsp1109I GCAGC 1 cut(s) 22
MalI GATC 1 cut(s) 104
MboI GATC 1 cut(s) 102
MboII GAAGA 4 cut(s) 190, 227, 274, 301
MluCI AATT 4 cut(s) 130, 182, 218, 274
MlyI GAGTC 1 cut(s) 97
MnlI CCTC 4 cut(s) 89, 114, 167, 308
MspR9I CCNGG 1 cut(s) 284
MvaI CCWGG 1 cut(s) 284
NdeII GATC 1 cut(s) 102
NlaIII CATG 1 cut(s) 95
PfeI GAWTC 1 cut(s) 236
PkrI GCNGC 1 cut(s) 12
PleI GAGTC 1 cut(s) 96
PpsI GAGTC 1 cut(s) 96
Psp6I CCWGG 1 cut(s) 282
PspGI CCWGG 1 cut(s) 282
SatI GCNGC 1 cut(s) 11
Sau3AI GATC 1 cut(s) 102
SchI GAGTC 1 cut(s) 97
ScrFI CCNGG 1 cut(s) 284
SetI ASST 5 cut(s) 9, 100, 125, 205, 288
SfcI CTRYAG 1 cut(s) 57
Sse9I AATT 4 cut(s) 130, 182, 218, 274
SsiI CCGC 1 cut(s) 41
StyD4I CCNGG 1 cut(s) 282
TaaI ACNGT 1 cut(s) 247
TaqI TCGA 2 cut(s) 170, 313
TasI AATT 4 cut(s) 130, 182, 218, 274
TfiI GAWTC 1 cut(s) 236
TseI GCWGC 1 cut(s) 10
XapI RAATTY 2 cut(s) 182, 274
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.