Rw6G025850

Ubiquitin exists either covalently attached to another protein, or free (unanchored). When covalently bound, it is conjugated to target proteins via an isopeptide bond either as a monomer (monoubiquitin), a polymer linked via different Lys residues of the ubiquitin (polyubiquitin chains) or a linear polymer linked via the initiator Met of the ubiquitin (linear polyubiquitin chains). Polyubiquitin chains, when attached to a target protein, have different functions depending on the Lys residue of the ubiquitin that is linked

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr6
OG0005522
Physical Location & Seq
Forward (+)
49322911 .. 49323897
987 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw6G025850.1

Sequence Viewer

Length: 867 bp
ATGGGGATTCCATGTAGCAGTCAGAAGCTTTTTCGTAAAGGGCAGCTGCTTGATGATGAAGCAGCACCCCTAGAAACATTCAACAACCAGCTGGAAGCTGAGAATAGTGTTATTTACGTGACTTTCGGGGCTGGCGATGATGACCAAGTCGACGAAATAGAAGATATAAGCTTAATATTTGAGAGAGACAAAAATGAAAAGGGTTTGATTGAATACAAGGTGGTTTATAAGAGCGAATCAGATGAGAACAGTGAATCAGGTGAAAGCAGCGATTCTGATAGTGATTCATCAGATTTAGTCTCTTCTTTCGAAATCAAGTTGAAATCATCTTGCACGATTTTCGATGTCAAGGCAGCAATCGAGAGCCTAAACAGCTTTCGAATTTGTACCCAAAAGCTATACTGGGATGATCATATTCTGGAAGATTGGGAAACAGTGGACGACGACATTACAAAGTGGTCCAGTGTCCCTGCTCCATTAACAATACACTTTGAGACACCCAGTTCTAGTTCTAATGTGGGGGCCAATAAAAATATTGTTTCTGCAGTTGACCGTGCAGACAAAACCCTTGACGAAGTTTTGGTTCCACAAGACATAAATGTTACTGGGCCGAATGGTGCAACCACCAAGGTGCATGTGAACCCTTCTTACAAATTCAAGGATGTAAAAGAGAAGATTGAACTAGATTGTGGAATCCCATTTGGTTTACAGAGACTTACTCATGATGGTGATGAACTTAATGATGATATGACTATAGGGCTTTATGAGGCATCGTTGGGCAGTCTGTGGAAATTAAGGTGGAACTTTTGTGGTACTTCCTGGTCATTCTTCTACCCATGGTACAAGGATTGTTGCAGGACTGGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03320 map03320
Pfam Domains
Protein Families
Motile_Sperm Pkinase ubiquitin

Protein Analysis

288

Amino Acids

32.33

Weight (kDa)

4.36

Isoelectric Point (pI)

40.08

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ubiquitin PF00240 199 - 256 1.9e-06 Ubiquitin family
Rad60-SLD PF11976 199 - 256 1.7e-06 Ubiquitin-2 like Rad60 SUMO-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 228
AccI GTMKAC 1 cut(s) 150
AcsI RAATTY 2 cut(s) 381, 653
AfaI GTAC 3 cut(s) 388, 814, 842
AgsI TTSAA 5 cut(s) 82, 212, 322, 658, 680
AjnI CCWGG 1 cut(s) 818
AleI CACNNNNGTG 1 cut(s) 629
AluBI AGCT 7 cut(s) 28, 46, 91, 98, 171, 375, 397
AluI AGCT 7 cut(s) 28, 46, 91, 98, 171, 375, 397
Alw26I GTCTC 4 cut(s) 180, 304, 488, 706
AoxI GGCC 2 cut(s) 522, 608
ApeKI GCWGC 5 cut(s) 43, 46, 62, 267, 353
ApoI RAATTY 2 cut(s) 381, 653
AspS9I GGNCC 3 cut(s) 459, 522, 608
AsuHPI GGTGA 2 cut(s) 272, 740
AsuII TTCGAA 2 cut(s) 309, 379
AvaII GGWCC 1 cut(s) 459
BbvI GCAGC 5 cut(s) 33, 55, 74, 279, 365
BccI CCATC 1 cut(s) 719
BcgI CGANNNNNNTGC 2 cut(s) 322, 356
BciT130I CCWGG 1 cut(s) 820
BclI TGATCA 1 cut(s) 409
BcoDI GTCTC 4 cut(s) 180, 304, 488, 706
BfaI CTAG 4 cut(s) 71, 507, 683, 865
BfmI CTRYAG 2 cut(s) 543, 753
BisI GCNGC 5 cut(s) 44, 47, 63, 268, 354
BlsI GCNGC 5 cut(s) 45, 48, 64, 269, 355
Bme1390I CCNGG 1 cut(s) 820
Bme18I GGWCC 1 cut(s) 459
BmgT120I GGNCC 3 cut(s) 459, 522, 608
BmiI GGNNCC 2 cut(s) 523, 585
BmrFI CCNGG 1 cut(s) 820
BmrI ACTGGG 3 cut(s) 412, 495, 615
BmsI GCATC 1 cut(s) 779
BmuI ACTGGG 3 cut(s) 412, 495, 615
BplI GAGNNNNNCTC 2 cut(s) 703, 735
Bpu14I TTCGAA 2 cut(s) 309, 379
BsaAI YACGTR 1 cut(s) 118
BsaJI CCNNGG 2 cut(s) 627, 836
Bse1I ACTGG 5 cut(s) 407, 462, 501, 610, 865
BseBI CCWGG 1 cut(s) 820
BseDI CCNNGG 2 cut(s) 627, 836
BseGI GGATG 2 cut(s) 412, 667
BseMII CTCAG 1 cut(s) 90
BseNI ACTGG 5 cut(s) 407, 462, 501, 610, 865
BseXI GCAGC 5 cut(s) 33, 55, 74, 279, 365
BsgI GTGCAG 1 cut(s) 576
BshFI GGCC 2 cut(s) 524, 610
BslFI GGGAC 1 cut(s) 452
BsmAI GTCTC 4 cut(s) 180, 304, 488, 706
BsmFI GGGAC 1 cut(s) 452
BsnI GGCC 2 cut(s) 524, 610
Bsp119I TTCGAA 2 cut(s) 309, 379
Bsp143I GATC 1 cut(s) 409
Bsp19I CCATGG 1 cut(s) 836
BspANI GGCC 2 cut(s) 524, 610
BspCNI CTCAG 1 cut(s) 91
BspHI TCATGA 1 cut(s) 721
BspLI GGNNCC 2 cut(s) 523, 585
BspMAI CTGCAG 1 cut(s) 547
BspT104I TTCGAA 2 cut(s) 309, 379
BsrI ACTGG 5 cut(s) 407, 462, 501, 610, 865
BssECI CCNNGG 2 cut(s) 627, 836
BssMI GATC 1 cut(s) 409
BssT1I CCWWGG 2 cut(s) 627, 836
Bst2UI CCWGG 1 cut(s) 820
Bst4CI ACNGT 3 cut(s) 251, 436, 554
Bst6I CTCTTC 1 cut(s) 307
BstBAI YACGTR 1 cut(s) 118
BstBI TTCGAA 2 cut(s) 309, 379
BstC8I GCNNGC 1 cut(s) 133
BstDEI CTNAG 1 cut(s) 99
BstDSI CCRYGG 1 cut(s) 836
BstF5I GGATG 2 cut(s) 412, 667
BstKTI GATC 1 cut(s) 412
BstMAI GTCTC 4 cut(s) 180, 304, 488, 706
BstMBI GATC 1 cut(s) 409
BstMWI GCNNNNNNNGC 2 cut(s) 372, 861
BstNI CCWGG 1 cut(s) 820
BstNSI RCATGY 1 cut(s) 638
BstSCI CCNGG 1 cut(s) 818
BstSFI CTRYAG 2 cut(s) 543, 753
BstV1I GCAGC 5 cut(s) 33, 55, 74, 279, 365
BsuRI GGCC 2 cut(s) 524, 610
BtgI CCRYGG 1 cut(s) 836
BtgZI GCGATG 1 cut(s) 150
BtsCI GGATG 2 cut(s) 412, 667
BtsIMutI CAGTG 3 cut(s) 256, 441, 469
Cac8I GCNNGC 1 cut(s) 133
CciI TCATGA 1 cut(s) 721
Cfr13I GGNCC 3 cut(s) 459, 522, 608
Csp6I GTAC 3 cut(s) 387, 813, 841
CviAII CATG 4 cut(s) 12, 635, 722, 837
CviQI GTAC 3 cut(s) 387, 813, 841
DdeI CTNAG 1 cut(s) 99
DpnI GATC 1 cut(s) 411
DpnII GATC 1 cut(s) 409
Eam1104I CTCTTC 1 cut(s) 307
EarI CTCTTC 1 cut(s) 307
Eco130I CCWWGG 2 cut(s) 627, 836
Eco47I GGWCC 1 cut(s) 459
EcoRII CCWGG 1 cut(s) 818
EcoT14I CCWWGG 2 cut(s) 627, 836
ErhI CCWWGG 2 cut(s) 627, 836
FaeI CATG 4 cut(s) 15, 638, 725, 840
FaqI GGGAC 1 cut(s) 452
FatI CATG 4 cut(s) 11, 634, 721, 836
FbaI TGATCA 1 cut(s) 409
FblI GTMKAC 1 cut(s) 150
Fnu4HI GCNGC 5 cut(s) 44, 47, 63, 268, 354
FokI GGATG 2 cut(s) 419, 674
Fsp4HI GCNGC 5 cut(s) 44, 47, 63, 268, 354
FspBI CTAG 4 cut(s) 71, 507, 683, 865
GluI GCNGC 5 cut(s) 44, 47, 63, 268, 354
HaeIII GGCC 2 cut(s) 524, 610
Hin1II CATG 4 cut(s) 15, 638, 725, 840
HincII GTYRAC 2 cut(s) 151, 550
HindII GTYRAC 2 cut(s) 151, 550
HindIII AAGCTT 2 cut(s) 26, 169
HinfI GANTC 6 cut(s) 7, 236, 254, 272, 284, 693
HphI GGTGA 2 cut(s) 272, 740
Hpy166II GTNNAC 5 cut(s) 151, 439, 550, 640, 707
Hpy188I TCNGA 4 cut(s) 24, 241, 277, 292
Hpy188III TCNNGA 3 cut(s) 361, 419, 722
Hpy8I GTNNAC 5 cut(s) 151, 439, 550, 640, 707
Hpy99I CGWCG 2 cut(s) 155, 446
HpyAV CCTTC 1 cut(s) 654
HpyCH4III ACNGT 3 cut(s) 251, 436, 554
HpyCH4IV ACGT 1 cut(s) 117
HpyCH4V TGCA 6 cut(s) 333, 545, 557, 620, 634, 855
HpyF10VI GCNNNNNNNGC 2 cut(s) 372, 861
HpyF3I CTNAG 1 cut(s) 99
HpySE526I ACGT 1 cut(s) 117
Hsp92II CATG 4 cut(s) 15, 638, 725, 840
Ksp22I TGATCA 1 cut(s) 409
Kzo9I GATC 1 cut(s) 409
LmnI GCTCC 1 cut(s) 478
Lsp1109I GCAGC 5 cut(s) 33, 55, 74, 279, 365
LweI GCATC 1 cut(s) 779
MaeI CTAG 4 cut(s) 71, 507, 683, 865
MaeII ACGT 1 cut(s) 117
MaeIII GTNAC 2 cut(s) 118, 601
MalI GATC 1 cut(s) 411
MboI GATC 1 cut(s) 409
MboII GAAGA 5 cut(s) 173, 294, 434, 685, 820
MluCI AATT 3 cut(s) 381, 653, 791
MnlI CCTC 1 cut(s) 760
MseI TTAA 4 cut(s) 173, 479, 738, 794
MslI CAYNNNNRTG 2 cut(s) 629, 726
MspA1I CMGCKG 2 cut(s) 46, 91
MspR9I CCNGG 1 cut(s) 820
MvaI CCWGG 1 cut(s) 820
MwoI GCNNNNNNNGC 2 cut(s) 372, 861
NcoI CCATGG 1 cut(s) 836
NdeII GATC 1 cut(s) 409
NlaIII CATG 4 cut(s) 15, 638, 725, 840
NlaIV GGNNCC 2 cut(s) 523, 585
NmuCI GTSAC 1 cut(s) 118
NspI RCATGY 1 cut(s) 638
NspV TTCGAA 2 cut(s) 309, 379
OliI CACNNNNGTG 1 cut(s) 629
PagI TCATGA 1 cut(s) 721
PcsI WCGNNNNNNNCGW 1 cut(s) 132
PfeI GAWTC 6 cut(s) 7, 236, 254, 272, 284, 693
PflFI GACNNNGTC 1 cut(s) 146
PkrI GCNGC 5 cut(s) 45, 48, 64, 269, 355
Ppu21I YACGTR 1 cut(s) 118
PsiI TTATAA 1 cut(s) 228
Psp6I CCWGG 1 cut(s) 818
PspGI CCWGG 1 cut(s) 818
PspN4I GGNNCC 2 cut(s) 523, 585
PspPI GGNCC 3 cut(s) 459, 522, 608
PsrI GAACNNNNNNTAC 2 cut(s) 632, 664
PstI CTGCAG 1 cut(s) 547
PsyI GACNNNGTC 1 cut(s) 146
PvuII CAGCTG 2 cut(s) 46, 91
RsaI GTAC 3 cut(s) 388, 814, 842
RsaNI GTAC 3 cut(s) 387, 813, 841
RseI CAYNNNNRTG 2 cut(s) 629, 726
SalI GTCGAC 1 cut(s) 149
SaqAI TTAA 4 cut(s) 173, 479, 738, 794
SatI GCNGC 5 cut(s) 44, 47, 63, 268, 354
Sau3AI GATC 1 cut(s) 409
Sau96I GGNCC 3 cut(s) 459, 522, 608
ScrFI CCNGG 1 cut(s) 820
SfaNI GCATC 1 cut(s) 779
SfcI CTRYAG 2 cut(s) 543, 753
SfuI TTCGAA 2 cut(s) 309, 379
SinI GGWCC 1 cut(s) 459
SmiMI CAYNNNNRTG 2 cut(s) 629, 726
Sse9I AATT 3 cut(s) 381, 653, 791
SspI AATATT 2 cut(s) 177, 535
SspMI CTAG 4 cut(s) 71, 507, 683, 865
StyD4I CCNGG 1 cut(s) 818
StyI CCWWGG 2 cut(s) 627, 836
TaaI ACNGT 3 cut(s) 251, 436, 554
TaiI ACGT 1 cut(s) 120
TaqI TCGA 5 cut(s) 150, 309, 342, 360, 379
TasI AATT 3 cut(s) 381, 653, 791
TfiI GAWTC 6 cut(s) 7, 236, 254, 272, 284, 693
Tru1I TTAA 4 cut(s) 173, 479, 738, 794
Tru9I TTAA 4 cut(s) 173, 479, 738, 794
TscAI CASTG 3 cut(s) 256, 441, 469
TseFI GTSAC 1 cut(s) 118
TseI GCWGC 5 cut(s) 43, 46, 62, 267, 353
Tsp45I GTSAC 1 cut(s) 118
TspDTI ATGAA 4 cut(s) 72, 210, 276, 747
TspRI CASTG 3 cut(s) 256, 441, 469
Tth111I GACNNNGTC 1 cut(s) 146
VpaK11BI GGWCC 1 cut(s) 459
XapI RAATTY 2 cut(s) 381, 653
XceI RCATGY 1 cut(s) 638
XmiI GTMKAC 1 cut(s) 150
XspI CTAG 4 cut(s) 71, 507, 683, 865
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.