Rmu_sc0010322.1_g000002

methyl-CpG-binding domain-containing protein 7-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010322.1
Physical Location & Seq
Reverse (-)
7047 .. 7403
357 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010322.1_g000002.1.cds

Sequence Viewer

Length: 255 bp
atgaacacacccaaatcatcatcgccggagccaattccactgatgacggtgactccggcaaaggaagaagaccaacccagaagctctaggcaactgcaattggtcactgcttcgcgctttggactcccagatggttggtctgttgaggaaaggccccgtcgctccagccaaacaggtttgactggtattgaaaagttgtctgggattttaagagtgaaaattggtccatataatttatccctgaaagttcactag

Protein Analysis

84

Amino Acids

9.28

Weight (kDa)

9.98

Isoelectric Point (pI)

74.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 115
AgsI TTSAA 1 cut(s) 191
AluBI AGCT 1 cut(s) 84
AluI AGCT 1 cut(s) 84
AoxI GGCC 1 cut(s) 152
AspLEI GCGC 1 cut(s) 117
AspS9I GGNCC 2 cut(s) 153, 224
AsuHPI GGTGA 1 cut(s) 61
AvaII GGWCC 1 cut(s) 224
BbsI GAAGAC 1 cut(s) 75
BccI CCATC 1 cut(s) 125
BfaI CTAG 2 cut(s) 87, 253
Bme18I GGWCC 1 cut(s) 224
BmgT120I GGNCC 2 cut(s) 153, 224
BmiI GGNNCC 2 cut(s) 30, 155
BpiI GAAGAC 1 cut(s) 75
BpmI CTGGAG 1 cut(s) 148
BsaXI ACNNNNNCTCC 2 cut(s) 37, 67
Bse1I ACTGG 1 cut(s) 187
BseNI ACTGG 1 cut(s) 187
Bsh1236I CGCG 1 cut(s) 115
BshFI GGCC 1 cut(s) 154
BsiSI CCGG 2 cut(s) 26, 56
BsnI GGCC 1 cut(s) 154
BspANI GGCC 1 cut(s) 154
BspFNI CGCG 1 cut(s) 115
BspLI GGNNCC 2 cut(s) 30, 155
BsrI ACTGG 1 cut(s) 187
Bst4CI ACNGT 1 cut(s) 49
BstFNI CGCG 1 cut(s) 115
BstHHI GCGC 1 cut(s) 117
BstUI CGCG 1 cut(s) 115
BstV2I GAAGAC 1 cut(s) 75
BstXI CCANNNNNNTGG 1 cut(s) 135
BsuRI GGCC 1 cut(s) 154
BtgZI GCGATG 1 cut(s) 6
BtsI GCAGTG 1 cut(s) 105
BtsIMutI CAGTG 2 cut(s) 38, 105
CfoI GCGC 1 cut(s) 117
Cfr13I GGNCC 2 cut(s) 153, 224
CviJI RGCY 4 cut(s) 31, 84, 154, 168
CviKI_1 RGCY 4 cut(s) 31, 84, 154, 168
Eco47I GGWCC 1 cut(s) 224
EcoO109I RGGNCCY 1 cut(s) 153
FaiI YATR 2 cut(s) 229, 231
FspBI CTAG 2 cut(s) 87, 253
GlaI GCGC 1 cut(s) 116
GsuI CTGGAG 1 cut(s) 148
HaeIII GGCC 1 cut(s) 154
HapII CCGG 2 cut(s) 26, 56
HhaI GCGC 1 cut(s) 117
Hin6I GCGC 1 cut(s) 115
HinP1I GCGC 1 cut(s) 115
HinfI GANTC 2 cut(s) 52, 123
HpaII CCGG 2 cut(s) 26, 56
HphI GGTGA 1 cut(s) 61
Hpy166II GTNNAC 1 cut(s) 250
Hpy8I GTNNAC 1 cut(s) 250
Hpy99I CGWCG 1 cut(s) 162
HpyCH4III ACNGT 1 cut(s) 49
HpyCH4V TGCA 1 cut(s) 97
HspAI GCGC 1 cut(s) 115
LmnI GCTCC 2 cut(s) 28, 167
LpnPI CCDG 8 cut(s) 39, 69, 91, 141, 159, 168, 178, 186
MaeI CTAG 2 cut(s) 87, 253
MaeIII GTNAC 2 cut(s) 49, 103
MboII GAAGA 2 cut(s) 77, 80
MfeI CAATTG 1 cut(s) 98
MluCI AATT 4 cut(s) 33, 98, 219, 232
MlyI GAGTC 2 cut(s) 46, 117
MnlI CCTC 1 cut(s) 139
MseI TTAA 1 cut(s) 209
MspI CCGG 2 cut(s) 26, 56
MunI CAATTG 1 cut(s) 98
MvnI CGCG 1 cut(s) 115
NlaIV GGNNCC 2 cut(s) 30, 155
NmuCI GTSAC 2 cut(s) 49, 103
PleI GAGTC 2 cut(s) 46, 117
PpsI GAGTC 2 cut(s) 46, 117
PspN4I GGNNCC 2 cut(s) 30, 155
PspPI GGNCC 2 cut(s) 153, 224
SaqAI TTAA 1 cut(s) 209
Sau96I GGNCC 2 cut(s) 153, 224
SchI GAGTC 2 cut(s) 46, 117
SetI ASST 2 cut(s) 86, 178
SinI GGWCC 1 cut(s) 224
Sse9I AATT 4 cut(s) 33, 98, 219, 232
SspMI CTAG 2 cut(s) 87, 253
TaaI ACNGT 1 cut(s) 49
TasI AATT 4 cut(s) 33, 98, 219, 232
Tru1I TTAA 1 cut(s) 209
Tru9I TTAA 1 cut(s) 209
TscAI CASTG 2 cut(s) 45, 112
TseFI GTSAC 2 cut(s) 49, 103
Tsp45I GTSAC 2 cut(s) 49, 103
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 2 cut(s) 45, 112
VpaK11BI GGWCC 1 cut(s) 224
XspI CTAG 2 cut(s) 87, 253
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.