Rmu_sc0010540.1_g000001

ion channel POLLUX-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010540.1
Physical Location & Seq
Reverse (-)
1 .. 429
429 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010540.1_g000001.1.cds

Sequence Viewer

Length: 186 bp
atgaaagaaggagagactccatccttcacggagcttgctgaaagagctcacttacggaaggaagttgccataggttatgtgaaaaacaataagaaggttgttaatccagttcccaagtcagaacccctctcccttgagttgacagattcgttaatagttatatctgaacttgaaggagaacaaccg

Protein Analysis

62

Amino Acids

6.89

Weight (kDa)

5.05

Isoelectric Point (pI)

38.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 173
AluBI AGCT 2 cut(s) 34, 47
AluI AGCT 2 cut(s) 34, 47
Alw21I GWGCWC 1 cut(s) 49
Alw26I GTCTC 1 cut(s) 8
BanII GRGCYC 1 cut(s) 49
Bbv12I GWGCWC 1 cut(s) 49
BccI CCATC 1 cut(s) 28
BcoDI GTCTC 1 cut(s) 8
BpuEI CTTGAG 1 cut(s) 155
Bse1I ACTGG 1 cut(s) 107
BseGI GGATG 1 cut(s) 20
BseNI ACTGG 1 cut(s) 107
BsiHKAI GWGCWC 1 cut(s) 49
BsmAI GTCTC 1 cut(s) 8
Bsp1286I GDGCHC 1 cut(s) 49
BsrI ACTGG 1 cut(s) 107
BstC8I GCNNGC 1 cut(s) 36
BstF5I GGATG 1 cut(s) 20
BstMAI GTCTC 1 cut(s) 8
BstMWI GCNNNNNNNGC 1 cut(s) 44
BtsCI GGATG 1 cut(s) 20
Cac8I GCNNGC 1 cut(s) 36
CviJI RGCY 2 cut(s) 34, 47
CviKI_1 RGCY 2 cut(s) 34, 47
Ecl136II GAGCTC 1 cut(s) 47
Eco24I GRGCYC 1 cut(s) 49
Eco53kI GAGCTC 1 cut(s) 47
EcoICRI GAGCTC 1 cut(s) 47
EcoT38I GRGCYC 1 cut(s) 49
FaiI YATR 3 cut(s) 71, 78, 161
FokI GGATG 1 cut(s) 7
FriOI GRGCYC 1 cut(s) 49
HincII GTYRAC 1 cut(s) 141
HindII GTYRAC 1 cut(s) 141
HinfI GANTC 2 cut(s) 16, 146
Hpy166II GTNNAC 1 cut(s) 141
Hpy188I TCNGA 2 cut(s) 121, 166
Hpy8I GTNNAC 1 cut(s) 141
HpyAV CCTTC 4 cut(s) 34, 52, 88, 167
HpyF10VI GCNNNNNNNGC 1 cut(s) 44
LmnI GCTCC 1 cut(s) 31
LpnPI CCDG 1 cut(s) 120
MhlI GDGCHC 1 cut(s) 49
MlyI GAGTC 1 cut(s) 10
MnlI CCTC 1 cut(s) 137
MseI TTAA 2 cut(s) 102, 152
MwoI GCNNNNNNNGC 1 cut(s) 44
PfeI GAWTC 1 cut(s) 146
PleI GAGTC 1 cut(s) 10
PpsI GAGTC 1 cut(s) 10
Psp124BI GAGCTC 1 cut(s) 49
SacI GAGCTC 1 cut(s) 49
SaqAI TTAA 2 cut(s) 102, 152
SchI GAGTC 1 cut(s) 10
SduI GDGCHC 1 cut(s) 49
SetI ASST 4 cut(s) 36, 49, 76, 99
SgeI CNNG 6 cut(s) 40, 47, 119, 127, 146, 182
SmlI CTYRAG 1 cut(s) 134
SmoI CTYRAG 1 cut(s) 134
SstI GAGCTC 1 cut(s) 49
TfiI GAWTC 1 cut(s) 146
Tru1I TTAA 2 cut(s) 102, 152
Tru9I TTAA 2 cut(s) 102, 152
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 2 cut(s) 44, 70
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.