Rmu_sc0011122.1_g000005

Alpha/beta hydrolase family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0011122.1
Physical Location & Seq
Forward (+)
26997 .. 28538
1542 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0011122.1_g000005.1.cds

Sequence Viewer

Length: 945 bp
atggaaaagatcgagcacaagtatgtggaagtaggaggactaaagcttcatgtagctgaaattggaagtggtccaaaggtggtgcttttcctgcatggatttccagaaatatggtactcgtggaggcaccaaatggttgctgttgccaacaatggctaccgggcaattgcctatgattgcaggggatatggactttctgagcagccagctgagcctgaaaaggctactttcaatgaccttgttgaagaggttcttggccttttggattctttggccattaacaaggctttccttgttggtaaggattttggagctatgcctgcatacatagtagctgctctccgtcctgatcgagtagctggtcttatatcactaggtattccttttatgctaccaggtcctactgctgtccaaaatcatcttcttcctgaaggtttctatgtatcaaggtggcaggagccagctgggagggcagaagcagattttggccgctttgatgttaagtcagtgataaggaacatctacattctcttctgtggaagtgaggttccagtagctgctaaggatcaagagatcatggatttgtttgatccagctattcctctaccaccatggttctctgaagaagatctttcagtctatgcatctctttatgagaagtctggattccgttttccattgcaaattccatacaggagtttagcagtggactgcggttatactgatccaaaagtctctgctccaacactgcttgtcatgggtgggaaagactacgtcttaaagattccggggtttggagattacatacgaactggggcagtaaagcaatttgtgcctgatttggacattaaatacattgcagaagggaatcatttcgtgcaagaacaacttccagagcaaattaatcagctaattctcacttttctaggaaaacatgggatctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

314

Amino Acids

34.91

Weight (kDa)

5.23

Isoelectric Point (pI)

40.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 126
AciI CCGC 2 cut(s) 490, 714
AclWI GGATC 3 cut(s) 573, 584, 719
AcoI YGGCCR 2 cut(s) 273, 487
AcsI RAATTY 1 cut(s) 684
AcuI CTGAAG 2 cut(s) 450, 642
AfaI GTAC 1 cut(s) 116
AfiI CCNNNNNNNGG 1 cut(s) 794
AgsI TTSAA 2 cut(s) 232, 245
AjnI CCWGG 1 cut(s) 394
AjuI GAANNNNNNNTTGG 6 cut(s) 237, 269, 405, 437, 468, 500
AloI GAACNNNNNNTCC 2 cut(s) 531, 563
Alw21I GWGCWC 1 cut(s) 18
Alw26I GTCTC 1 cut(s) 739
AlwI GGATC 3 cut(s) 573, 584, 719
AlwNI CAGNNNCTG 1 cut(s) 557
AoxI GGCC 3 cut(s) 256, 273, 487
ApeKI GCWGC 3 cut(s) 202, 335, 557
ApoI RAATTY 1 cut(s) 684
AseI ATTAAT 1 cut(s) 903
Asp700I GAANNNNTTC 3 cut(s) 249, 872, 888
AspS9I GGNCC 2 cut(s) 71, 398
AsuC2I CCSGG 2 cut(s) 161, 789
AvaII GGWCC 2 cut(s) 71, 398
BalI TGGCCA 1 cut(s) 275
BanI GGYRCC 1 cut(s) 126
BauI CACGAG 1 cut(s) 118
Bbv12I GWGCWC 1 cut(s) 18
BbvI GCAGC 3 cut(s) 214, 322, 544
BciT130I CCWGG 1 cut(s) 396
BcnI CCSGG 2 cut(s) 161, 789
BcoDI GTCTC 1 cut(s) 739
BfaI CTAG 2 cut(s) 374, 926
BglII AGATCT 1 cut(s) 628
BisI GCNGC 4 cut(s) 203, 336, 490, 558
BlpI GCTNAGC 1 cut(s) 210
BlsI GCNGC 4 cut(s) 204, 337, 491, 559
Bme1390I CCNGG 3 cut(s) 161, 396, 789
Bme18I GGWCC 2 cut(s) 71, 398
BmgT120I GGNCC 2 cut(s) 71, 398
BmiI GGNNCC 3 cut(s) 128, 459, 549
BmrFI CCNGG 3 cut(s) 161, 396, 789
BmrI ACTGGG 1 cut(s) 822
BmsI GCATC 1 cut(s) 653
BmuI ACTGGG 1 cut(s) 822
Bpu10I CCTNAGC 1 cut(s) 561
Bpu1102I GCTNAGC 1 cut(s) 210
BpuMI CCSGG 2 cut(s) 161, 789
BsaJI CCNNGG 2 cut(s) 611, 788
Bsc4I CCNNNNNNNGG 1 cut(s) 794
Bse1I ACTGG 2 cut(s) 551, 817
Bse3DI GCAATG 2 cut(s) 677, 855
BseBI CCWGG 1 cut(s) 396
BseDI CCNNGG 2 cut(s) 611, 788
BseLI CCNNNNNNNGG 1 cut(s) 794
BseMI GCAATG 2 cut(s) 677, 855
BseMII CTCAG 2 cut(s) 189, 201
BseNI ACTGG 2 cut(s) 551, 817
BseXI GCAGC 3 cut(s) 214, 322, 544
BseYI CCCAGC 1 cut(s) 464
BshFI GGCC 3 cut(s) 258, 275, 489
BshNI GGYRCC 1 cut(s) 126
BsiHKAI GWGCWC 1 cut(s) 18
BsiSI CCGG 2 cut(s) 160, 788
BslI CCNNNNNNNGG 1 cut(s) 794
BsmAI GTCTC 1 cut(s) 739
BsnI GGCC 3 cut(s) 258, 275, 489
Bsp1286I GDGCHC 1 cut(s) 18
Bsp143I GATC 8 cut(s) 9, 349, 565, 573, 589, 628, 724, 939
Bsp1720I GCTNAGC 1 cut(s) 210
Bsp19I CCATGG 1 cut(s) 611
BspACI CCGC 2 cut(s) 490, 714
BspANI GGCC 3 cut(s) 258, 275, 489
BspCNI CTCAG 2 cut(s) 190, 202
BspLI GGNNCC 3 cut(s) 128, 459, 549
BspPI GGATC 3 cut(s) 573, 584, 719
BspT107I GGYRCC 1 cut(s) 126
BsrDI GCAATG 2 cut(s) 677, 855
BsrI ACTGG 2 cut(s) 551, 817
BssECI CCNNGG 2 cut(s) 611, 788
BssMI GATC 8 cut(s) 9, 349, 565, 573, 589, 628, 724, 939
BssSI CACGAG 1 cut(s) 118
BssT1I CCWWGG 1 cut(s) 611
Bst2BI CACGAG 1 cut(s) 118
Bst2UI CCWGG 1 cut(s) 396
Bst6I CTCTTC 2 cut(s) 240, 536
BstAPI GCANNNNNTGC 1 cut(s) 832
BstC8I GCNNGC 3 cut(s) 207, 321, 462
BstDEI CTNAG 3 cut(s) 198, 210, 561
BstDSI CCRYGG 1 cut(s) 611
BstKTI GATC 8 cut(s) 12, 352, 568, 576, 592, 631, 727, 942
BstMAI GTCTC 1 cut(s) 739
BstMBI GATC 8 cut(s) 9, 349, 565, 573, 589, 628, 724, 939
BstMWI GCNNNNNNNGC 5 cut(s) 91, 211, 320, 470, 832
BstNI CCWGG 1 cut(s) 396
BstSCI CCNGG 3 cut(s) 159, 394, 787
BstV1I GCAGC 3 cut(s) 214, 322, 544
BstX2I RGATCY 2 cut(s) 628, 939
BstXI CCANNNNNNTGG 1 cut(s) 111
BstYI RGATCY 2 cut(s) 628, 939
BsuRI GGCC 3 cut(s) 258, 275, 489
BtgI CCRYGG 1 cut(s) 611
BtsI GCAGTG 2 cut(s) 711, 746
BtsIMutI CAGTG 3 cut(s) 513, 711, 746
Cac8I GCNNGC 3 cut(s) 207, 321, 462
CaiI CAGNNNCTG 1 cut(s) 557
Cfr13I GGNCC 2 cut(s) 71, 398
CsiI ACCWGGT 1 cut(s) 394
Csp6I GTAC 1 cut(s) 115
CviAII CATG 6 cut(s) 50, 95, 577, 612, 757, 935
CviQI GTAC 1 cut(s) 115
DdeI CTNAG 3 cut(s) 198, 210, 561
DpnI GATC 8 cut(s) 11, 351, 567, 575, 591, 630, 726, 941
DpnII GATC 8 cut(s) 9, 349, 565, 573, 589, 628, 724, 939
EaeI YGGCCR 2 cut(s) 273, 487
Eam1104I CTCTTC 2 cut(s) 240, 536
EarI CTCTTC 2 cut(s) 240, 536
Eco130I CCWWGG 1 cut(s) 611
Eco47I GGWCC 2 cut(s) 71, 398
Eco57I CTGAAG 2 cut(s) 450, 642
EcoO109I RGGNCCY 1 cut(s) 398
EcoRII CCWGG 1 cut(s) 394
EcoT14I CCWWGG 1 cut(s) 611
EcoT22I ATGCAT 1 cut(s) 646
ErhI CCWWGG 1 cut(s) 611
FaeI CATG 6 cut(s) 53, 98, 580, 615, 760, 938
FalI AAGNNNNNCTT 6 cut(s) 237, 269, 615, 647, 873, 905
FatI CATG 6 cut(s) 49, 94, 576, 611, 756, 934
Fnu4HI GCNGC 4 cut(s) 203, 336, 490, 558
Fsp4HI GCNGC 4 cut(s) 203, 336, 490, 558
FspBI CTAG 2 cut(s) 374, 926
GluI GCNGC 4 cut(s) 203, 336, 490, 558
GsaI CCCAGC 1 cut(s) 468
HaeIII GGCC 3 cut(s) 258, 275, 489
HapII CCGG 2 cut(s) 160, 788
Hin1II CATG 6 cut(s) 53, 98, 580, 615, 760, 938
HindIII AAGCTT 1 cut(s) 44
HinfI GANTC 4 cut(s) 266, 666, 784, 868
HpaII CCGG 2 cut(s) 160, 788
Hpy166II GTNNAC 1 cut(s) 709
Hpy188I TCNGA 3 cut(s) 199, 622, 944
Hpy188III TCNNGA 6 cut(s) 104, 347, 428, 569, 663, 893
Hpy8I GTNNAC 1 cut(s) 709
HpyAV CCTTC 2 cut(s) 425, 857
HpyCH4IV ACGT 1 cut(s) 774
HpyCH4V TGCA 7 cut(s) 94, 180, 323, 644, 682, 860, 880
HpyF10VI GCNNNNNNNGC 5 cut(s) 91, 211, 320, 470, 832
HpyF3I CTNAG 3 cut(s) 198, 210, 561
HpySE526I ACGT 1 cut(s) 774
Hsp92II CATG 6 cut(s) 53, 98, 580, 615, 760, 938
Kzo9I GATC 8 cut(s) 9, 349, 565, 573, 589, 628, 724, 939
LmnI GCTCC 3 cut(s) 311, 457, 745
Lsp1109I GCAGC 3 cut(s) 214, 322, 544
LweI GCATC 1 cut(s) 653
MabI ACCWGGT 1 cut(s) 394
MaeI CTAG 2 cut(s) 374, 926
MaeII ACGT 1 cut(s) 774
MalI GATC 8 cut(s) 11, 351, 567, 575, 591, 630, 726, 941
MboI GATC 8 cut(s) 9, 349, 565, 573, 589, 628, 724, 939
MboII GAAGA 6 cut(s) 257, 413, 416, 523, 635, 638
MfeI CAATTG 1 cut(s) 165
MflI RGATCY 2 cut(s) 628, 939
MhlI GDGCHC 1 cut(s) 18
MlsI TGGCCA 1 cut(s) 275
MluCI AATT 6 cut(s) 60, 165, 684, 827, 900, 912
MluNI TGGCCA 1 cut(s) 275
MmeI TCCRAC 1 cut(s) 767
MnlI CCTC 6 cut(s) 29, 117, 241, 462, 538, 612
Mox20I TGGCCA 1 cut(s) 275
Mph1103I ATGCAT 1 cut(s) 646
MroXI GAANNNNTTC 3 cut(s) 249, 872, 888
MscI TGGCCA 1 cut(s) 275
MseI TTAA 5 cut(s) 279, 501, 779, 849, 903
MslI CAYNNNNRTG 1 cut(s) 21
Msp20I TGGCCA 1 cut(s) 275
MspA1I CMGCKG 2 cut(s) 209, 464
MspI CCGG 2 cut(s) 160, 788
MspR9I CCNGG 3 cut(s) 161, 396, 789
MunI CAATTG 1 cut(s) 165
MvaI CCWGG 1 cut(s) 396
MwoI GCNNNNNNNGC 5 cut(s) 91, 211, 320, 470, 832
NciI CCSGG 2 cut(s) 161, 789
NcoI CCATGG 1 cut(s) 611
NdeII GATC 8 cut(s) 9, 349, 565, 573, 589, 628, 724, 939
NlaIII CATG 6 cut(s) 53, 98, 580, 615, 760, 938
NlaIV GGNNCC 3 cut(s) 128, 459, 549
NsiI ATGCAT 1 cut(s) 646
PdmI GAANNNNTTC 3 cut(s) 249, 872, 888
PfeI GAWTC 4 cut(s) 266, 666, 784, 868
PflFI GACNNNGTC 1 cut(s) 773
PkrI GCNGC 4 cut(s) 204, 337, 491, 559
PpuMI RGGWCCY 1 cut(s) 398
PshBI ATTAAT 1 cut(s) 903
Psp5II RGGWCCY 1 cut(s) 398
Psp6I CCWGG 1 cut(s) 394
PspFI CCCAGC 1 cut(s) 464
PspGI CCWGG 1 cut(s) 394
PspN4I GGNNCC 3 cut(s) 128, 459, 549
PspPI GGNCC 2 cut(s) 71, 398
PspPPI RGGWCCY 1 cut(s) 398
PstNI CAGNNNCTG 1 cut(s) 557
PsuI RGATCY 2 cut(s) 628, 939
PsyI GACNNNGTC 1 cut(s) 773
PvuII CAGCTG 2 cut(s) 209, 464
RsaI GTAC 1 cut(s) 116
RsaNI GTAC 1 cut(s) 115
RseI CAYNNNNRTG 1 cut(s) 21
SaqAI TTAA 5 cut(s) 279, 501, 779, 849, 903
SatI GCNGC 4 cut(s) 203, 336, 490, 558
Sau3AI GATC 8 cut(s) 9, 349, 565, 573, 589, 628, 724, 939
Sau96I GGNCC 2 cut(s) 71, 398
ScrFI CCNGG 3 cut(s) 161, 396, 789
SduI GDGCHC 1 cut(s) 18
SexAI ACCWGGT 1 cut(s) 394
SfaNI GCATC 1 cut(s) 653
SinI GGWCC 2 cut(s) 71, 398
SmiMI CAYNNNNRTG 1 cut(s) 21
Sse9I AATT 6 cut(s) 60, 165, 684, 827, 900, 912
SsiI CCGC 2 cut(s) 490, 714
SspMI CTAG 2 cut(s) 374, 926
StyD4I CCNGG 3 cut(s) 159, 394, 787
StyI CCWWGG 1 cut(s) 611
TaiI ACGT 1 cut(s) 777
TaqI TCGA 2 cut(s) 12, 352
TasI AATT 6 cut(s) 60, 165, 684, 827, 900, 912
TauI GCSGC 1 cut(s) 492
TfiI GAWTC 4 cut(s) 266, 666, 784, 868
Tru1I TTAA 5 cut(s) 279, 501, 779, 849, 903
Tru9I TTAA 5 cut(s) 279, 501, 779, 849, 903
TscAI CASTG 3 cut(s) 513, 711, 753
TseI GCWGC 3 cut(s) 202, 335, 557
TspDTI ATGAA 1 cut(s) 38
TspGWI ACGGA 2 cut(s) 332, 659
TspRI CASTG 3 cut(s) 513, 711, 753
Tth111I GACNNNGTC 1 cut(s) 773
VpaK11BI GGWCC 2 cut(s) 71, 398
VspI ATTAAT 1 cut(s) 903
XapI RAATTY 1 cut(s) 684
XmnI GAANNNNTTC 3 cut(s) 249, 872, 888
XspI CTAG 2 cut(s) 374, 926
Zsp2I ATGCAT 1 cut(s) 646
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.