Rmu_sc0021476.1_g000001

F-box family protein-related

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0021476.1
Physical Location & Seq
Reverse (-)
376 .. 1658
1283 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0021476.1_g000001.1.cds

Sequence Viewer

Length: 1119 bp
atgaagcaggatgaagtttttgttaatcttatccagaggaagagtgctggttggttcaatgtggaatctgctgaagatctgcttggcaatattctttcaaggcttccagttaagctccttctaactatcaaggtcgtttctaaactttggcatagattgatttgcagtccaaatttcactagactgcatttaagcaaatcaagagaaaagtccatctatatactttatccttttatggatgctaaaagaagtctgtatttcatggatgctgacggggtgatcaccggaacaatcagtcttactggtttaaaaaatataccatctctatgtatgattgcttcctacaatgggttgatatgtttcactaattatccttggtttcctcattcatttaagactcgagcagtagtgacaggcttggaaatccgaatttgcaatcctgcaactcgtgaagtttggctacttcctaatgggagccaaatgaaacaggagctaggaattggggttgcctttggcccgggaatcagtgagtatagggtacttcggtttttctgttccaaatccaaatctgatgtaattcaccctgagtgtgagatatttcaatcaagcaccggaacctggagaagcttaggttttgttcagcattgtcctatgggtgcacatcatgtatttgttcatggaaaagttttttggtttattccttcagaagaagatcataatatccctggatccattctttcagttggtttcgacgaagattttagaattatcagacttccagttgcggtcactgaacatgccttcttggttgatcttgaaggtcaattatcactgatcgttgtatttgatgatgatgacactatggttatatggattttgaaggatgaaaatgagtccatttgggaggagaaatgtcgtgatggtattccctatgaaactgtggagtgtcttgactctgtagctgcaagaaaaactgacatttttttcatcactgaagaacgctatttcatcttcagtatgataaaaatgtcctggaaagaaactcatttcaaagaactatttgaacaacattctcctgttgtttttacgtacacagaaagcctcctcccttgtcactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

372

Amino Acids

42.77

Weight (kDa)

5.92

Isoelectric Point (pI)

43.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 785
AclWI GGATC 2 cut(s) 723, 736
AcsI RAATTY 2 cut(s) 172, 429
AcuI CTGAAG 4 cut(s) 93, 687, 997, 1014
AfaI GTAC 2 cut(s) 540, 1091
AfiI CCNNNNNNNGG 2 cut(s) 348, 618
AgsI TTSAA 7 cut(s) 58, 99, 602, 818, 880, 1051, 1064
AjnI CCWGG 3 cut(s) 617, 724, 1031
AjuI GAANNNNNNNTTGG 4 cut(s) 66, 98, 673, 705
AluBI AGCT 4 cut(s) 115, 493, 627, 962
AluI AGCT 4 cut(s) 115, 493, 627, 962
Alw21I GWGCWC 1 cut(s) 661
Alw44I GTGCAC 1 cut(s) 657
AlwI GGATC 2 cut(s) 723, 736
Ama87I CYCGRG 2 cut(s) 399, 517
AoxI GGCC 1 cut(s) 514
ApaLI GTGCAC 1 cut(s) 657
ApeKI GCWGC 1 cut(s) 962
ApoI RAATTY 2 cut(s) 172, 429
AspS9I GGNCC 1 cut(s) 515
AsuC2I CCSGG 2 cut(s) 518, 519
AsuHPI GGTGA 3 cut(s) 274, 289, 572
AvaI CYCGRG 2 cut(s) 399, 517
BaeGI GKGCMC 1 cut(s) 661
BaeI ACNNNNGTAYC 2 cut(s) 530, 563
BamHI GGATCC 1 cut(s) 728
BarI GAAGNNNNNNTAC 4 cut(s) 322, 354, 444, 476
BauI CACGAG 1 cut(s) 447
Bbv12I GWGCWC 1 cut(s) 661
BbvI GCAGC 1 cut(s) 949
BccI CCATC 3 cut(s) 221, 328, 914
BciT130I CCWGG 3 cut(s) 619, 726, 1033
BclI TGATCA 1 cut(s) 279
BcnI CCSGG 2 cut(s) 518, 519
BfaI CTAG 2 cut(s) 180, 494
BfmI CTRYAG 1 cut(s) 957
BglII AGATCT 1 cut(s) 76
BisI GCNGC 1 cut(s) 963
BlsI GCNGC 1 cut(s) 964
Bme1390I CCNGG 5 cut(s) 518, 519, 619, 726, 1033
BmeT110I CYCGRG 2 cut(s) 399, 517
BmgT120I GGNCC 1 cut(s) 515
BmiI GGNNCC 3 cut(s) 476, 616, 730
BmrFI CCNGG 5 cut(s) 518, 519, 619, 726, 1033
BmsI GCATC 2 cut(s) 229, 256
BpmI CTGGAG 1 cut(s) 640
Bpu10I CCTNAGC 1 cut(s) 628
BpuMI CCSGG 2 cut(s) 518, 519
BsaAI YACGTR 1 cut(s) 1089
BsaJI CCNNGG 3 cut(s) 374, 517, 724
BsaWI WCCGGW 2 cut(s) 284, 611
Bsc4I CCNNNNNNNGG 2 cut(s) 348, 618
Bse1I ACTGG 3 cut(s) 107, 307, 779
BseBI CCWGG 3 cut(s) 619, 726, 1033
BseDI CCNNGG 3 cut(s) 374, 517, 724
BseGI GGATG 4 cut(s) 16, 244, 271, 889
BseLI CCNNNNNNNGG 2 cut(s) 348, 618
BseMII CTCAG 1 cut(s) 576
BseNI ACTGG 3 cut(s) 107, 307, 779
BseRI GAGGAG 2 cut(s) 920, 1094
BseSI GKGCMC 1 cut(s) 661
BseXI GCAGC 1 cut(s) 949
BshFI GGCC 1 cut(s) 516
BsiHKAI GWGCWC 1 cut(s) 661
BsiHKCI CYCGRG 2 cut(s) 399, 517
BsiSI CCGG 3 cut(s) 285, 518, 612
BslI CCNNNNNNNGG 2 cut(s) 348, 618
BsnI GGCC 1 cut(s) 516
BsoBI CYCGRG 2 cut(s) 399, 517
Bsp1286I GDGCHC 1 cut(s) 661
Bsp143I GATC 6 cut(s) 76, 279, 712, 728, 811, 834
BspACI CCGC 1 cut(s) 785
BspANI GGCC 1 cut(s) 516
BspCNI CTCAG 1 cut(s) 577
BspLI GGNNCC 3 cut(s) 476, 616, 730
BspPI GGATC 2 cut(s) 723, 736
BsrI ACTGG 3 cut(s) 107, 307, 779
BssECI CCNNGG 3 cut(s) 374, 517, 724
BssMI GATC 6 cut(s) 76, 279, 712, 728, 811, 834
BssSI CACGAG 1 cut(s) 447
BssT1I CCWWGG 1 cut(s) 374
Bst2BI CACGAG 1 cut(s) 447
Bst2UI CCWGG 3 cut(s) 619, 726, 1033
Bst4CI ACNGT 1 cut(s) 940
Bst6I CTCTTC 1 cut(s) 35
BstBAI YACGTR 1 cut(s) 1089
BstDEI CTNAG 2 cut(s) 585, 628
BstF5I GGATG 4 cut(s) 16, 244, 271, 889
BstKTI GATC 6 cut(s) 79, 282, 715, 731, 814, 837
BstMBI GATC 6 cut(s) 76, 279, 712, 728, 811, 834
BstNI CCWGG 3 cut(s) 619, 726, 1033
BstNSI RCATGY 1 cut(s) 800
BstSCI CCNGG 5 cut(s) 516, 517, 617, 724, 1031
BstSFI CTRYAG 1 cut(s) 957
BstSLI GKGCMC 1 cut(s) 661
BstSNI TACGTA 1 cut(s) 1089
BstV1I GCAGC 1 cut(s) 949
BstX2I RGATCY 2 cut(s) 76, 728
BstYI RGATCY 2 cut(s) 76, 728
BsuRI GGCC 1 cut(s) 516
BtsCI GGATG 4 cut(s) 16, 244, 271, 889
BtsIMutI CAGTG 5 cut(s) 532, 789, 830, 990, 1114
Cfr13I GGNCC 1 cut(s) 515
Cfr9I CCCGGG 1 cut(s) 517
Csp6I GTAC 2 cut(s) 539, 1090
CviAII CATG 4 cut(s) 262, 665, 677, 797
CviQI GTAC 2 cut(s) 539, 1090
DdeI CTNAG 2 cut(s) 585, 628
DpnI GATC 6 cut(s) 78, 281, 714, 730, 813, 836
DpnII GATC 6 cut(s) 76, 279, 712, 728, 811, 834
DraI TTTAAA 1 cut(s) 309
Eam1104I CTCTTC 1 cut(s) 35
EarI CTCTTC 1 cut(s) 35
Eco105I TACGTA 1 cut(s) 1089
Eco130I CCWWGG 1 cut(s) 374
Eco57I CTGAAG 4 cut(s) 93, 687, 997, 1014
Eco88I CYCGRG 2 cut(s) 399, 517
EcoRII CCWGG 3 cut(s) 617, 724, 1031
EcoT14I CCWWGG 1 cut(s) 374
ErhI CCWWGG 1 cut(s) 374
FaeI CATG 4 cut(s) 265, 668, 680, 800
FalI AAGNNNNNCTT 2 cut(s) 66, 98
FatI CATG 4 cut(s) 261, 664, 676, 796
FbaI TGATCA 1 cut(s) 279
Fnu4HI GCNGC 1 cut(s) 963
FokI GGATG 4 cut(s) 23, 251, 278, 896
Fsp4HI GCNGC 1 cut(s) 963
FspBI CTAG 2 cut(s) 180, 494
GluI GCNGC 1 cut(s) 963
GsuI CTGGAG 1 cut(s) 640
HaeIII GGCC 1 cut(s) 516
HapII CCGG 3 cut(s) 285, 518, 612
Hin1II CATG 4 cut(s) 265, 668, 680, 800
HindIII AAGCTT 1 cut(s) 625
HinfI GANTC 5 cut(s) 65, 397, 522, 893, 953
HpaII CCGG 3 cut(s) 285, 518, 612
HphI GGTGA 3 cut(s) 274, 289, 572
Hpy166II GTNNAC 2 cut(s) 659, 1092
Hpy188I TCNGA 4 cut(s) 428, 571, 706, 773
Hpy188III TCNNGA 6 cut(s) 34, 201, 449, 815, 917, 950
Hpy8I GTNNAC 2 cut(s) 659, 1092
Hpy99I CGWCG 1 cut(s) 755
HpyAV CCTTC 5 cut(s) 128, 711, 811, 812, 874
HpyCH4III ACNGT 1 cut(s) 940
HpyCH4IV ACGT 1 cut(s) 1088
HpyCH4V TGCA 6 cut(s) 165, 187, 435, 443, 659, 965
HpyF3I CTNAG 2 cut(s) 585, 628
HpySE526I ACGT 1 cut(s) 1088
Hsp92II CATG 4 cut(s) 265, 668, 680, 800
Ksp22I TGATCA 1 cut(s) 279
Kzo9I GATC 6 cut(s) 76, 279, 712, 728, 811, 834
LmnI GCTCC 3 cut(s) 120, 474, 490
Lsp1109I GCAGC 1 cut(s) 949
LweI GCATC 2 cut(s) 229, 256
MaeI CTAG 2 cut(s) 180, 494
MaeII ACGT 1 cut(s) 1088
MaeIII GTNAC 3 cut(s) 409, 787, 1112
MalI GATC 6 cut(s) 78, 281, 714, 730, 813, 836
MboI GATC 6 cut(s) 76, 279, 712, 728, 811, 834
MboII GAAGA 7 cut(s) 52, 86, 719, 722, 767, 1003, 1007
MflI RGATCY 2 cut(s) 76, 728
MhlI GDGCHC 1 cut(s) 661
MluCI AATT 7 cut(s) 172, 367, 429, 498, 576, 765, 824
MlyI GAGTC 3 cut(s) 391, 902, 947
MnlI CCTC 5 cut(s) 30, 393, 898, 1112, 1115
MseI TTAA 5 cut(s) 24, 111, 191, 308, 393
MslI CAYNNNNRTG 1 cut(s) 325
MspI CCGG 3 cut(s) 285, 518, 612
MspR9I CCNGG 5 cut(s) 518, 519, 619, 726, 1033
MvaI CCWGG 3 cut(s) 619, 726, 1033
NciI CCSGG 2 cut(s) 518, 519
NdeII GATC 6 cut(s) 76, 279, 712, 728, 811, 834
NlaIII CATG 4 cut(s) 265, 668, 680, 800
NlaIV GGNNCC 3 cut(s) 476, 616, 730
NmuCI GTSAC 3 cut(s) 409, 787, 1112
NspI RCATGY 1 cut(s) 800
PaeR7I CTCGAG 1 cut(s) 399
PfeI GAWTC 2 cut(s) 65, 522
PfoI TCCNGGA 1 cut(s) 1031
PkrI GCNGC 1 cut(s) 964
PleI GAGTC 3 cut(s) 391, 901, 947
PpsI GAGTC 3 cut(s) 391, 901, 947
Ppu21I YACGTR 1 cut(s) 1089
Psp6I CCWGG 3 cut(s) 617, 724, 1031
PspGI CCWGG 3 cut(s) 617, 724, 1031
PspN4I GGNNCC 3 cut(s) 476, 616, 730
PspPI GGNCC 1 cut(s) 515
PspXI VCTCGAGB 1 cut(s) 399
PsuI RGATCY 2 cut(s) 76, 728
RsaI GTAC 2 cut(s) 540, 1091
RsaNI GTAC 2 cut(s) 539, 1090
RseI CAYNNNNRTG 1 cut(s) 325
SaqAI TTAA 5 cut(s) 24, 111, 191, 308, 393
SatI GCNGC 1 cut(s) 963
Sau3AI GATC 6 cut(s) 76, 279, 712, 728, 811, 834
Sau96I GGNCC 1 cut(s) 515
SchI GAGTC 3 cut(s) 391, 902, 947
ScrFI CCNGG 5 cut(s) 518, 519, 619, 726, 1033
SduI GDGCHC 1 cut(s) 661
SetI ASST 9 cut(s) 117, 135, 495, 620, 629, 634, 823, 964, 1091
SfaNI GCATC 2 cut(s) 229, 256
SfcI CTRYAG 1 cut(s) 957
Sfr274I CTCGAG 1 cut(s) 399
SlaI CTCGAG 1 cut(s) 399
SmaI CCCGGG 1 cut(s) 519
SmiMI CAYNNNNRTG 1 cut(s) 325
SmlI CTYRAG 1 cut(s) 399
SmoI CTYRAG 1 cut(s) 399
SnaBI TACGTA 1 cut(s) 1089
Sse9I AATT 7 cut(s) 172, 367, 429, 498, 576, 765, 824
SsiI CCGC 1 cut(s) 785
SspI AATATT 1 cut(s) 91
SspMI CTAG 2 cut(s) 180, 494
StyD4I CCNGG 5 cut(s) 516, 517, 617, 724, 1031
StyI CCWWGG 1 cut(s) 374
TaaI ACNGT 1 cut(s) 940
TaiI ACGT 1 cut(s) 1091
TaqI TCGA 2 cut(s) 400, 750
TasI AATT 7 cut(s) 172, 367, 429, 498, 576, 765, 824
TfiI GAWTC 2 cut(s) 65, 522
Tru1I TTAA 5 cut(s) 24, 111, 191, 308, 393
Tru9I TTAA 5 cut(s) 24, 111, 191, 308, 393
TscAI CASTG 4 cut(s) 532, 796, 837, 997
TseFI GTSAC 3 cut(s) 409, 787, 1112
TseI GCWGC 1 cut(s) 962
Tsp45I GTSAC 3 cut(s) 409, 787, 1112
TspMI CCCGGG 1 cut(s) 517
TspRI CASTG 4 cut(s) 532, 796, 837, 997
VneI GTGCAC 1 cut(s) 657
XapI RAATTY 2 cut(s) 172, 429
XceI RCATGY 1 cut(s) 800
XhoI CTCGAG 1 cut(s) 399
XmaI CCCGGG 1 cut(s) 517
XspI CTAG 2 cut(s) 180, 494
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.