Rh5DG265700

F-box family protein-related

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
OG0002820
Physical Location & Seq
Forward (+)
32094997 .. 32100308
5312 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG265700.1

Sequence Viewer

Length: 507 bp
ATGAAGCAGGATGAATTTTTTGTTAATCTTATCCAGAGGAAGAGTGCTGGTTGGTTCAATGTGGAATCTGCTGAAGATCTGCTTGGCAATATTCTTTCAAGGCTTCCAGTTAAGCTCCTTCTAACTATCAAGGTCGTTTCTAAACTTTGGCATAGATTGATTTGCAGTCCAAATTTCACTAGACTTCATTTAAGCAAATCAAGAGAAAAGTCCATCTATATACTTTATCCTTTTCTGGATGCTAAAAGAAGTCTGTATTTCATGGATGCTGAGGGGGTGATCACCGGAACAATCAGTCTTACTGGTTTAAAAAATATACCATCTCTATGTATGATTGCTTCCTACAATGGGTTGATATGTTTCACTAATTATCCTTGGTTTCCTCATTCATTTAAGAATCGAGCAGTAGTGACAGGCTTGGAAATCCGAATTTGCAATCCTGCAACTCGTGAAGTTTGGCTACTTCCTTGGAACTTAACTTATTTAGTGGTCAATACACAGAGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
F-box FBA_3

Protein Analysis

168

Amino Acids

19.34

Weight (kDa)

9.51

Isoelectric Point (pI)

41.05

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
F-box PF00646 25 - 61 3.4e-07 F-box domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 3 cut(s) 14, 172, 429
AcuI CTGAAG 1 cut(s) 93
AfiI CCNNNNNNNGG 1 cut(s) 348
AgsI TTSAA 2 cut(s) 58, 99
AjuI GAANNNNNNNTTGG 2 cut(s) 66, 98
AluBI AGCT 1 cut(s) 115
AluI AGCT 1 cut(s) 115
ApoI RAATTY 3 cut(s) 14, 172, 429
AsuHPI GGTGA 2 cut(s) 274, 289
BarI GAAGNNNNNNTAC 4 cut(s) 322, 354, 444, 476
BauI CACGAG 1 cut(s) 447
BbvCI CCTCAGC 1 cut(s) 270
BccI CCATC 2 cut(s) 221, 328
BclI TGATCA 1 cut(s) 279
BfaI CTAG 1 cut(s) 180
BglII AGATCT 1 cut(s) 76
BmsI GCATC 2 cut(s) 229, 256
Bpu10I CCTNAGC 1 cut(s) 270
BsaJI CCNNGG 2 cut(s) 374, 467
BsaWI WCCGGW 1 cut(s) 284
Bsc4I CCNNNNNNNGG 1 cut(s) 348
Bse1I ACTGG 2 cut(s) 107, 307
BseDI CCNNGG 2 cut(s) 374, 467
BseGI GGATG 3 cut(s) 16, 244, 271
BseLI CCNNNNNNNGG 1 cut(s) 348
BseMII CTCAG 1 cut(s) 261
BseNI ACTGG 2 cut(s) 107, 307
BsiSI CCGG 1 cut(s) 285
BslI CCNNNNNNNGG 1 cut(s) 348
Bsp143I GATC 2 cut(s) 76, 279
BspCNI CTCAG 1 cut(s) 262
BsrI ACTGG 2 cut(s) 107, 307
BssECI CCNNGG 2 cut(s) 374, 467
BssMI GATC 2 cut(s) 76, 279
BssSI CACGAG 1 cut(s) 447
BssT1I CCWWGG 2 cut(s) 374, 467
Bst2BI CACGAG 1 cut(s) 447
Bst6I CTCTTC 1 cut(s) 35
BstDEI CTNAG 1 cut(s) 270
BstF5I GGATG 3 cut(s) 16, 244, 271
BstKTI GATC 2 cut(s) 79, 282
BstMBI GATC 2 cut(s) 76, 279
BstX2I RGATCY 1 cut(s) 76
BstYI RGATCY 1 cut(s) 76
BtsCI GGATG 3 cut(s) 16, 244, 271
CviAII CATG 1 cut(s) 262
CviJI RGCY 4 cut(s) 103, 115, 417, 460
CviKI_1 RGCY 4 cut(s) 103, 115, 417, 460
DdeI CTNAG 1 cut(s) 270
DpnI GATC 2 cut(s) 78, 281
DpnII GATC 2 cut(s) 76, 279
DraI TTTAAA 1 cut(s) 309
Eam1104I CTCTTC 1 cut(s) 35
EarI CTCTTC 1 cut(s) 35
Eco130I CCWWGG 2 cut(s) 374, 467
Eco57I CTGAAG 1 cut(s) 93
EcoT14I CCWWGG 2 cut(s) 374, 467
ErhI CCWWGG 2 cut(s) 374, 467
FaeI CATG 1 cut(s) 265
FaiI YATR 8 cut(s) 153, 219, 221, 263, 317, 328, 332, 358
FalI AAGNNNNNCTT 2 cut(s) 66, 98
FatI CATG 1 cut(s) 261
FbaI TGATCA 1 cut(s) 279
FokI GGATG 3 cut(s) 23, 251, 278
FspBI CTAG 1 cut(s) 180
HapII CCGG 1 cut(s) 285
Hin1II CATG 1 cut(s) 265
HinfI GANTC 2 cut(s) 65, 397
HpaII CCGG 1 cut(s) 285
HphI GGTGA 2 cut(s) 274, 289
Hpy188I TCNGA 1 cut(s) 428
Hpy188III TCNNGA 4 cut(s) 34, 201, 236, 449
HpyAV CCTTC 1 cut(s) 128
HpyCH4V TGCA 3 cut(s) 165, 435, 443
HpyF3I CTNAG 1 cut(s) 270
Hsp92II CATG 1 cut(s) 265
Ksp22I TGATCA 1 cut(s) 279
Kzo9I GATC 2 cut(s) 76, 279
LmnI GCTCC 1 cut(s) 120
LpnPI CCDG 8 cut(s) 33, 47, 120, 221, 288, 298, 399, 453
LweI GCATC 2 cut(s) 229, 256
MaeI CTAG 1 cut(s) 180
MaeIII GTNAC 1 cut(s) 409
MalI GATC 2 cut(s) 78, 281
MboI GATC 2 cut(s) 76, 279
MboII GAAGA 2 cut(s) 52, 86
MflI RGATCY 1 cut(s) 76
MluCI AATT 4 cut(s) 14, 172, 367, 429
MnlI CCTC 3 cut(s) 30, 265, 393
MseI TTAA 6 cut(s) 24, 111, 191, 308, 393, 476
MslI CAYNNNNRTG 1 cut(s) 325
MspI CCGG 1 cut(s) 285
NdeII GATC 2 cut(s) 76, 279
NlaIII CATG 1 cut(s) 265
NmuCI GTSAC 1 cut(s) 409
PfeI GAWTC 2 cut(s) 65, 397
PsuI RGATCY 1 cut(s) 76
RseI CAYNNNNRTG 1 cut(s) 325
SaqAI TTAA 6 cut(s) 24, 111, 191, 308, 393, 476
Sau3AI GATC 2 cut(s) 76, 279
SetI ASST 2 cut(s) 117, 135
SfaNI GCATC 2 cut(s) 229, 256
SmiMI CAYNNNNRTG 1 cut(s) 325
Sse9I AATT 4 cut(s) 14, 172, 367, 429
SspI AATATT 1 cut(s) 91
SspMI CTAG 1 cut(s) 180
StyI CCWWGG 2 cut(s) 374, 467
TaqI TCGA 1 cut(s) 400
TasI AATT 4 cut(s) 14, 172, 367, 429
TfiI GAWTC 2 cut(s) 65, 397
Tru1I TTAA 6 cut(s) 24, 111, 191, 308, 393, 476
Tru9I TTAA 6 cut(s) 24, 111, 191, 308, 393, 476
TseFI GTSAC 1 cut(s) 409
Tsp45I GTSAC 1 cut(s) 409
TspDTI ATGAA 5 cut(s) 17, 27, 176, 250, 378
XapI RAATTY 3 cut(s) 14, 172, 429
XspI CTAG 1 cut(s) 180
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.