Rorug05G0166100

F-box family protein-related

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
Physical Location & Seq
Reverse (-)
15376128 .. 15378834
2707 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0166100.1

Sequence Viewer

Length: 216 bp
ATGAAAGATTTGATCGAATTCTGCCAGGAAAACAAAGTTGGCCCAATTGAGGGCTTGCAGGTTCATCCTCGACATGCGAATGCAACCAAGCTTCAGATGCAAAGGATGCACGAAATGGAGCAGTTAGCAAGTGTTCAGGGCATGCCAACTGATAGGAACACATTGAATAAGCTAATGGTAATAACAACCATCACATGGCCAGGGGAGGAGCTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

71

Amino Acids

8.16

Weight (kDa)

5.83

Isoelectric Point (pI)

51.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 49
AccB7I CCANNNNNTGG 1 cut(s) 195
AcoI YGGCCR 1 cut(s) 197
AcsI RAATTY 1 cut(s) 17
AcuI CTGAAG 1 cut(s) 77
AfiI CCNNNNNNNGG 3 cut(s) 49, 50, 195
AgsI TTSAA 1 cut(s) 166
AjnI CCWGG 2 cut(s) 24, 199
AjuI GAANNNNNNNTTGG 2 cut(s) 21, 53
AluBI AGCT 3 cut(s) 91, 172, 211
AluI AGCT 3 cut(s) 91, 172, 211
AoxI GGCC 2 cut(s) 40, 197
ApoI RAATTY 1 cut(s) 17
AspS9I GGNCC 1 cut(s) 41
BalI TGGCCA 1 cut(s) 199
BccI CCATC 1 cut(s) 197
BciT130I CCWGG 2 cut(s) 26, 201
BfuAI ACCTGC 1 cut(s) 49
Bme1390I CCNGG 2 cut(s) 26, 201
BmgT120I GGNCC 1 cut(s) 41
BmrFI CCNGG 2 cut(s) 26, 201
BmsI GCATC 2 cut(s) 87, 96
BsaJI CCNNGG 1 cut(s) 200
Bsc4I CCNNNNNNNGG 3 cut(s) 49, 50, 195
BseBI CCWGG 2 cut(s) 26, 201
BseDI CCNNGG 1 cut(s) 200
BseGI GGATG 2 cut(s) 64, 111
BseLI CCNNNNNNNGG 3 cut(s) 49, 50, 195
BshFI GGCC 2 cut(s) 42, 199
BslI CCNNNNNNNGG 3 cut(s) 49, 50, 195
BsmI GAATGC 1 cut(s) 85
BsnI GGCC 2 cut(s) 42, 199
Bsp143I GATC 1 cut(s) 12
BspANI GGCC 2 cut(s) 42, 199
BspMI ACCTGC 1 cut(s) 49
BssECI CCNNGG 1 cut(s) 200
BssMI GATC 1 cut(s) 12
Bst2UI CCWGG 2 cut(s) 26, 201
BstAPI GCANNNNNTGC 1 cut(s) 106
BstC8I GCNNGC 2 cut(s) 56, 143
BstF5I GGATG 2 cut(s) 64, 111
BstKTI GATC 1 cut(s) 15
BstMBI GATC 1 cut(s) 12
BstMWI GCNNNNNNNGC 2 cut(s) 97, 106
BstNI CCWGG 2 cut(s) 26, 201
BstNSI RCATGY 2 cut(s) 77, 145
BstSCI CCNGG 2 cut(s) 24, 199
BsuRI GGCC 2 cut(s) 42, 199
BtsCI GGATG 2 cut(s) 64, 111
BveI ACCTGC 1 cut(s) 49
Cac8I GCNNGC 2 cut(s) 56, 143
Cfr13I GGNCC 1 cut(s) 41
CviAII CATG 3 cut(s) 74, 142, 195
CviJI RGCY 6 cut(s) 42, 54, 91, 172, 199, 211
CviKI_1 RGCY 6 cut(s) 42, 54, 91, 172, 199, 211
DpnI GATC 1 cut(s) 14
DpnII GATC 1 cut(s) 12
EaeI YGGCCR 1 cut(s) 197
Eco57I CTGAAG 1 cut(s) 77
EcoRI GAATTC 1 cut(s) 17
EcoRII CCWGG 2 cut(s) 24, 199
FaeI CATG 3 cut(s) 77, 145, 198
FaiI YATR 3 cut(s) 75, 143, 196
FatI CATG 3 cut(s) 73, 141, 194
FokI GGATG 2 cut(s) 51, 118
HaeIII GGCC 2 cut(s) 42, 199
Hin1II CATG 3 cut(s) 77, 145, 198
HindIII AAGCTT 1 cut(s) 89
Hpy188I TCNGA 1 cut(s) 96
HpyCH4V TGCA 4 cut(s) 58, 83, 100, 109
HpyF10VI GCNNNNNNNGC 2 cut(s) 97, 106
Hsp92II CATG 3 cut(s) 77, 145, 198
Kzo9I GATC 1 cut(s) 12
LmnI GCTCC 2 cut(s) 118, 208
LpnPI CCDG 5 cut(s) 11, 38, 44, 122, 186
LweI GCATC 2 cut(s) 87, 96
MalI GATC 1 cut(s) 14
MboI GATC 1 cut(s) 12
MfeI CAATTG 1 cut(s) 45
MlsI TGGCCA 1 cut(s) 199
MluCI AATT 2 cut(s) 17, 45
MluNI TGGCCA 1 cut(s) 199
MnlI CCTC 3 cut(s) 43, 78, 199
Mox20I TGGCCA 1 cut(s) 199
MscI TGGCCA 1 cut(s) 199
MslI CAYNNNNRTG 1 cut(s) 78
Msp20I TGGCCA 1 cut(s) 199
MspR9I CCNGG 2 cut(s) 26, 201
MunI CAATTG 1 cut(s) 45
Mva1269I GAATGC 1 cut(s) 85
MvaI CCWGG 2 cut(s) 26, 201
MwoI GCNNNNNNNGC 2 cut(s) 97, 106
NdeII GATC 1 cut(s) 12
NlaIII CATG 3 cut(s) 77, 145, 198
NspI RCATGY 2 cut(s) 77, 145
PaeI GCATGC 1 cut(s) 145
PctI GAATGC 1 cut(s) 85
PflMI CCANNNNNTGG 1 cut(s) 195
Psp6I CCWGG 2 cut(s) 24, 199
PspGI CCWGG 2 cut(s) 24, 199
PspPI GGNCC 1 cut(s) 41
RseI CAYNNNNRTG 1 cut(s) 78
Sau3AI GATC 1 cut(s) 12
Sau96I GGNCC 1 cut(s) 41
ScrFI CCNGG 2 cut(s) 26, 201
SetI ASST 4 cut(s) 63, 93, 174, 213
SfaNI GCATC 2 cut(s) 87, 96
SmiMI CAYNNNNRTG 1 cut(s) 78
SphI GCATGC 1 cut(s) 145
Sse9I AATT 2 cut(s) 17, 45
StyD4I CCNGG 2 cut(s) 24, 199
TaqI TCGA 2 cut(s) 15, 70
TasI AATT 2 cut(s) 17, 45
TspDTI ATGAA 2 cut(s) 17, 53
Van91I CCANNNNNTGG 1 cut(s) 195
XapI RAATTY 1 cut(s) 17
XceI RCATGY 2 cut(s) 77, 145
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.