Rmu_ssc0000110.1_g000002

synthase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000110.1
Physical Location & Seq
Forward (+)
2876 .. 3628
753 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000110.1_g000002.1.cds

Sequence Viewer

Length: 753 bp
atgaactggcaacacttcgcattattcttgttgcagcatgaatcatatgcctcacaattggagggtctaaagcagattgtttctaaagctttacttgtgtcgagtactaaagacgatgcttgttcgattttaaagctcgcagacttgatgcagcggttaggagtagcataccacttcaaaaaggagatccaggcagctatagttactcttgtttcttccagtactgctagtaccacaaccaatcttcaaaaagtttctttgcaatttcaaatactaagacaatatggtatttcaattagctcaggtaatgtactatacctacatccatataaaaagggccatacatatatatactcacaagtgacattctgtggccctgatgttgacatgttactttcaaactccacagatttgttttttaaggatggcgaagaaagcttaagcaacgatgtggagggacttctgtgtttgtatgaagcctcacaccttggaatgccaggagaagatgttctggaggaagccaagagttttaggtcgaaaaacttgaagcaatccttagcaaaattgaacgaagaaaatctactgaagcgggtagaacaattactggaaattcctgtacactggaggatgcctaggatagaagctctaaacttcatcaacatataccaaagggatgattctagtaacctggctctgcttgagttagccgaactggactataatcttgttcaatcagtctatcaaatgagataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

250

Amino Acids

28.4

Weight (kDa)

5.66

Isoelectric Point (pI)

38.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 154, 589
AclWI GGATC 1 cut(s) 181
AcsI RAATTY 1 cut(s) 609
AcuI CTGAAG 1 cut(s) 605
AfaI GTAC 5 cut(s) 106, 223, 232, 312, 618
AflII CTTAAG 1 cut(s) 439
AflIII ACRYGT 1 cut(s) 387
AgsI TTSAA 8 cut(s) 178, 248, 269, 294, 399, 547, 568, 731
AjnI CCWGG 3 cut(s) 189, 496, 687
AloI GAACNNNNNNTCC 2 cut(s) 492, 524
AluBI AGCT 6 cut(s) 89, 136, 197, 300, 438, 644
AluI AGCT 6 cut(s) 89, 136, 197, 300, 438, 644
AlwI GGATC 1 cut(s) 181
AoxI GGCC 2 cut(s) 337, 373
ApeKI GCWGC 3 cut(s) 34, 151, 194
ApoI RAATTY 1 cut(s) 609
Asp700I GAANNNNTTC 1 cut(s) 507
AspA2I CCTAGG 1 cut(s) 632
AspS9I GGNCC 2 cut(s) 337, 374
AvrII CCTAGG 1 cut(s) 632
BarI GAAGNNNNNNTAC 2 cut(s) 564, 596
BbvI GCAGC 3 cut(s) 46, 163, 206
BccI CCATC 1 cut(s) 419
BciT130I CCWGG 3 cut(s) 191, 498, 689
BfaI CTAG 3 cut(s) 228, 633, 681
BfmI CTRYAG 1 cut(s) 198
BfrI CTTAAG 1 cut(s) 439
BisI GCNGC 3 cut(s) 35, 152, 195
BlnI CCTAGG 1 cut(s) 632
BlsI GCNGC 3 cut(s) 36, 153, 196
BmcAI AGTACT 2 cut(s) 106, 223
Bme1390I CCNGG 3 cut(s) 191, 498, 689
BmgT120I GGNCC 2 cut(s) 337, 374
BmrFI CCNGG 3 cut(s) 191, 498, 689
BmsI GCATC 3 cut(s) 106, 138, 618
BpmI CTGGAG 2 cut(s) 533, 643
Bpu10I CCTNAGC 2 cut(s) 301, 556
BpuEI CTTGAG 1 cut(s) 719
BsaJI CCNNGG 2 cut(s) 487, 632
BsaXI ACNNNNNCTCC 2 cut(s) 492, 522
Bse1I ACTGG 5 cut(s) 11, 219, 609, 626, 717
BseBI CCWGG 3 cut(s) 191, 498, 689
BseDI CCNNGG 2 cut(s) 487, 632
BseGI GGATG 4 cut(s) 322, 430, 633, 679
BseMII CTCAG 1 cut(s) 315
BseNI ACTGG 5 cut(s) 11, 219, 609, 626, 717
BseXI GCAGC 3 cut(s) 46, 163, 206
BshFI GGCC 2 cut(s) 339, 375
BslFI GGGAC 1 cut(s) 471
BsmFI GGGAC 1 cut(s) 471
BsmI GAATGC 1 cut(s) 498
BsnI GGCC 2 cut(s) 339, 375
Bsp1407I TGTACA 1 cut(s) 616
Bsp143I GATC 1 cut(s) 186
BspACI CCGC 2 cut(s) 154, 589
BspANI GGCC 2 cut(s) 339, 375
BspCNI CTCAG 1 cut(s) 314
BspPI GGATC 1 cut(s) 181
BspTI CTTAAG 1 cut(s) 439
BsrGI TGTACA 1 cut(s) 616
BsrI ACTGG 5 cut(s) 11, 219, 609, 626, 717
BssECI CCNNGG 2 cut(s) 487, 632
BssMI GATC 1 cut(s) 186
BssT1I CCWWGG 2 cut(s) 487, 632
Bst2UI CCWGG 3 cut(s) 191, 498, 689
BstAFI CTTAAG 1 cut(s) 439
BstAUI TGTACA 1 cut(s) 616
BstC8I GCNNGC 1 cut(s) 138
BstDEI CTNAG 3 cut(s) 275, 301, 556
BstF5I GGATG 4 cut(s) 322, 430, 633, 679
BstKTI GATC 1 cut(s) 189
BstMBI GATC 1 cut(s) 186
BstMWI GCNNNNNNNGC 1 cut(s) 435
BstNI CCWGG 3 cut(s) 191, 498, 689
BstNSI RCATGY 1 cut(s) 391
BstSCI CCNGG 3 cut(s) 189, 496, 687
BstSFI CTRYAG 1 cut(s) 198
BstV1I GCAGC 3 cut(s) 46, 163, 206
BstX2I RGATCY 1 cut(s) 186
BstYI RGATCY 1 cut(s) 186
BsuRI GGCC 2 cut(s) 339, 375
BtsCI GGATG 4 cut(s) 322, 430, 633, 679
BtsIMutI CAGTG 1 cut(s) 619
Cac8I GCNNGC 1 cut(s) 138
Cfr13I GGNCC 2 cut(s) 337, 374
Csp6I GTAC 5 cut(s) 105, 222, 231, 311, 617
CviAII CATG 2 cut(s) 38, 388
CviQI GTAC 5 cut(s) 105, 222, 231, 311, 617
DdeI CTNAG 3 cut(s) 275, 301, 556
DpnI GATC 1 cut(s) 188
DpnII GATC 1 cut(s) 186
DraI TTTAAA 1 cut(s) 132
Eco130I CCWWGG 2 cut(s) 487, 632
Eco57I CTGAAG 1 cut(s) 605
EcoRII CCWGG 3 cut(s) 189, 496, 687
EcoT14I CCWWGG 2 cut(s) 487, 632
ErhI CCWWGG 2 cut(s) 487, 632
FaeI CATG 2 cut(s) 41, 391
FalI AAGNNNNNCTT 4 cut(s) 78, 110, 539, 571
FaqI GGGAC 1 cut(s) 471
FatI CATG 2 cut(s) 37, 387
FauI CCCGC 1 cut(s) 582
FauNDI CATATG 1 cut(s) 46
Fnu4HI GCNGC 3 cut(s) 35, 152, 195
FokI GGATG 4 cut(s) 309, 437, 640, 686
Fsp4HI GCNGC 3 cut(s) 35, 152, 195
FspBI CTAG 3 cut(s) 228, 633, 681
GluI GCNGC 3 cut(s) 35, 152, 195
GsuI CTGGAG 2 cut(s) 533, 643
HaeIII GGCC 2 cut(s) 339, 375
Hin1II CATG 2 cut(s) 41, 391
HincII GTYRAC 1 cut(s) 385
HindII GTYRAC 1 cut(s) 385
HindIII AAGCTT 2 cut(s) 87, 436
HinfI GANTC 2 cut(s) 41, 677
Hpy166II GTNNAC 2 cut(s) 385, 619
Hpy188III TCNNGA 1 cut(s) 512
Hpy8I GTNNAC 2 cut(s) 385, 619
HpyCH4V TGCA 3 cut(s) 34, 151, 262
HpyF10VI GCNNNNNNNGC 1 cut(s) 435
HpyF3I CTNAG 3 cut(s) 275, 301, 556
Hsp92II CATG 2 cut(s) 41, 391
Kzo9I GATC 1 cut(s) 186
Lsp1109I GCAGC 3 cut(s) 46, 163, 206
LweI GCATC 3 cut(s) 106, 138, 618
MaeI CTAG 3 cut(s) 228, 633, 681
MaeIII GTNAC 4 cut(s) 202, 361, 390, 683
MalI GATC 1 cut(s) 188
MboI GATC 1 cut(s) 186
MboII GAAGA 5 cut(s) 207, 236, 443, 515, 584
MfeI CAATTG 1 cut(s) 56
MflI RGATCY 1 cut(s) 186
MluCI AATT 6 cut(s) 56, 263, 294, 563, 599, 609
MnlI CCTC 6 cut(s) 55, 61, 448, 490, 508, 618
MroXI GAANNNNTTC 1 cut(s) 507
MseI TTAA 3 cut(s) 131, 420, 440
MspA1I CMGCKG 1 cut(s) 154
MspCI CTTAAG 1 cut(s) 439
MspR9I CCNGG 3 cut(s) 191, 498, 689
MunI CAATTG 1 cut(s) 56
Mva1269I GAATGC 1 cut(s) 498
MvaI CCWGG 3 cut(s) 191, 498, 689
MwoI GCNNNNNNNGC 1 cut(s) 435
NdeI CATATG 1 cut(s) 46
NdeII GATC 1 cut(s) 186
NlaIII CATG 2 cut(s) 41, 391
NmuCI GTSAC 1 cut(s) 361
NspI RCATGY 1 cut(s) 391
PciI ACATGT 1 cut(s) 387
PctI GAATGC 1 cut(s) 498
PdmI GAANNNNTTC 1 cut(s) 507
PfeI GAWTC 2 cut(s) 41, 677
PkrI GCNGC 3 cut(s) 36, 153, 196
PscI ACATGT 1 cut(s) 387
Psp6I CCWGG 3 cut(s) 189, 496, 687
PspGI CCWGG 3 cut(s) 189, 496, 687
PspPI GGNCC 2 cut(s) 337, 374
PsuI RGATCY 1 cut(s) 186
RsaI GTAC 5 cut(s) 106, 223, 232, 312, 618
RsaNI GTAC 5 cut(s) 105, 222, 231, 311, 617
SaqAI TTAA 3 cut(s) 131, 420, 440
SatI GCNGC 3 cut(s) 35, 152, 195
Sau3AI GATC 1 cut(s) 186
Sau96I GGNCC 2 cut(s) 337, 374
ScaI AGTACT 2 cut(s) 106, 223
ScrFI CCNGG 3 cut(s) 191, 498, 689
SfaNI GCATC 3 cut(s) 106, 138, 618
SfcI CTRYAG 1 cut(s) 198
SmlI CTYRAG 2 cut(s) 439, 698
SmoI CTYRAG 2 cut(s) 439, 698
Sse9I AATT 6 cut(s) 56, 263, 294, 563, 599, 609
SsiI CCGC 2 cut(s) 154, 589
SspMI CTAG 3 cut(s) 228, 633, 681
StyD4I CCNGG 3 cut(s) 189, 496, 687
StyI CCWWGG 2 cut(s) 487, 632
TaqI TCGA 3 cut(s) 101, 125, 536
TasI AATT 6 cut(s) 56, 263, 294, 563, 599, 609
TatI WGTACW 4 cut(s) 104, 221, 310, 616
TfiI GAWTC 2 cut(s) 41, 677
Tru1I TTAA 3 cut(s) 131, 420, 440
Tru9I TTAA 3 cut(s) 131, 420, 440
TscAI CASTG 1 cut(s) 626
TseFI GTSAC 1 cut(s) 361
TseI GCWGC 3 cut(s) 34, 151, 194
Tsp45I GTSAC 1 cut(s) 361
TspDTI ATGAA 4 cut(s) 17, 54, 489, 643
TspRI CASTG 1 cut(s) 626
Vha464I CTTAAG 1 cut(s) 439
XapI RAATTY 1 cut(s) 609
XceI RCATGY 1 cut(s) 391
XmaJI CCTAGG 1 cut(s) 632
XmnI GAANNNNTTC 1 cut(s) 507
XspI CTAG 3 cut(s) 228, 633, 681
ZrmI AGTACT 2 cut(s) 106, 223
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.