Rh1BG190200

synthase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
Physical Location & Seq
Reverse (-)
30466812 .. 30467236
425 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG190200.1

Sequence Viewer

Length: 207 bp
ATGACTCGACTCAGCGATGATTTGGGCACTTCCAAGGCTGAGAACGAGAGAGGAGATGTTGCGAAATCCGTTCAATGCTACATGGAAGAAAAAGTCATATCGGAAGAAGAAGCAGAGGAATACATAAAGGGCTTAATCTGCTATTCATGGAAGAAAATCAATGAAGAGAGTGCCAAAGCTACTATACCAAAATCCATTGTAAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

68

Amino Acids

7.7

Weight (kDa)

4.95

Isoelectric Point (pI)

34.83

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Terpene_synth_C PF03936 1 - 52 6.3e-14 Terpene synthase family, metal binding domain
Terpene_syn_C_2 PF19086 1 - 52 7.6e-13 Terpene synthase family 2, C-terminal metal binding
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 74
AluBI AGCT 1 cut(s) 179
AluI AGCT 1 cut(s) 179
BaeGI GKGCMC 1 cut(s) 29
BsaJI CCNNGG 1 cut(s) 33
BseDI CCNNGG 1 cut(s) 33
BseMII CTCAG 2 cut(s) 25, 30
BseRI GAGGAG 1 cut(s) 66
BseSI GKGCMC 1 cut(s) 29
Bsp1286I GDGCHC 1 cut(s) 29
BspCNI CTCAG 2 cut(s) 24, 31
BssECI CCNNGG 1 cut(s) 33
BssT1I CCWWGG 1 cut(s) 33
Bst6I CTCTTC 1 cut(s) 159
BstDEI CTNAG 2 cut(s) 11, 39
BstMWI GCNNNNNNNGC 1 cut(s) 138
BstSLI GKGCMC 1 cut(s) 29
BtgZI GCGATG 1 cut(s) 30
CviAII CATG 2 cut(s) 82, 147
CviJI RGCY 3 cut(s) 38, 132, 179
CviKI_1 RGCY 3 cut(s) 38, 132, 179
DdeI CTNAG 2 cut(s) 11, 39
Eam1104I CTCTTC 1 cut(s) 159
EarI CTCTTC 1 cut(s) 159
Eco130I CCWWGG 1 cut(s) 33
EcoT14I CCWWGG 1 cut(s) 33
ErhI CCWWGG 1 cut(s) 33
FaeI CATG 2 cut(s) 85, 150
FaiI YATR 5 cut(s) 83, 98, 125, 148, 185
FatI CATG 2 cut(s) 81, 146
Hin1II CATG 2 cut(s) 85, 150
HinfI GANTC 2 cut(s) 4, 9
Hpy188I TCNGA 1 cut(s) 103
HpyF10VI GCNNNNNNNGC 1 cut(s) 138
HpyF3I CTNAG 2 cut(s) 11, 39
Hsp92II CATG 2 cut(s) 85, 150
MboII GAAGA 5 cut(s) 98, 116, 119, 163, 176
MhlI GDGCHC 1 cut(s) 29
MlyI GAGTC 1 cut(s) 3
MnlI CCTC 2 cut(s) 44, 109
MseI TTAA 1 cut(s) 134
MwoI GCNNNNNNNGC 1 cut(s) 138
NlaIII CATG 2 cut(s) 85, 150
PleI GAGTC 1 cut(s) 3
PpsI GAGTC 1 cut(s) 3
SaqAI TTAA 1 cut(s) 134
SchI GAGTC 1 cut(s) 3
SduI GDGCHC 1 cut(s) 29
SetI ASST 1 cut(s) 181
SgeI CNNG 5 cut(s) 18, 46, 58, 94, 159
StyI CCWWGG 1 cut(s) 33
TaqI TCGA 1 cut(s) 7
Tru1I TTAA 1 cut(s) 134
Tru9I TTAA 1 cut(s) 134
TspDTI ATGAA 2 cut(s) 135, 177
TspGWI ACGGA 1 cut(s) 58
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.