Rmu_ssc0000200.1_g000010

Protein of unknown function (DUF707)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000200.1
OG0001946
Physical Location & Seq
Forward (+)
51293 .. 53573
2281 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 735 bp
atggaccctgttttgagcttgcagtgggaatataagaaaaccaaagagaaaatgaggtttgttgcgacagcttttgtggcgattctgtttggcttctttctaggagtgtcatttccaaccatttcgttaactaagatgaatttcccacccagccatttttcttccattgatatttcatacatagcggagaagtactcggggttctcaacccaagcactggtgaatgcctggtcttctttgaagagcaacagagatatctctgtaaaatacatccctaatgatgcaaaggacttaaccatcaagccaaaatatcttgtaacctttactgtaggccatgctcagaaaaaaaatatagatgccgcagttaaaaagacaagtgaatgggatcagtttgaggggtcaaagcaggctatccatgtgagcattcagaagcaaactaaatggtggtgtgccaagcgttttttgcatcctgacattgtggcatcctatgaatacatattaatttgggatgaggatatcggtgtggagcactttaatgcagaggaatacataaaactagtaaggaaatatgggttggaagtatcacagtctggtttagaaccaaataatgggctaacatggcagatgacaaaggagaggcagacagaggagaaacctggttggtgtaatgatccgcatttgccgccctgtgcagcgtatgtaactatatcttatccatcaccctctgggaaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF707

Protein Analysis

244

Amino Acids

27.92

Weight (kDa)

8.56

Isoelectric Point (pI)

32.17

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF707 PF05212 84 - 239 2.1e-48 Protein of unknown function (DUF707)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 217, 608
AciI CCGC 4 cut(s) 185, 360, 674, 683
AclWI GGATC 2 cut(s) 393, 665
AcsI RAATTY 1 cut(s) 139
AfaI GTAC 1 cut(s) 194
AfiI CCNNNNNNNGG 2 cut(s) 217, 608
AgsI TTSAA 1 cut(s) 241
AhlI ACTAGT 1 cut(s) 556
AjnI CCWGG 2 cut(s) 227, 655
AjuI GAANNNNNNNTTGG 2 cut(s) 557, 589
AluBI AGCT 2 cut(s) 18, 71
AluI AGCT 2 cut(s) 18, 71
Alw21I GWGCWC 1 cut(s) 531
AlwI GGATC 2 cut(s) 393, 665
Ama87I CYCGRG 1 cut(s) 196
AoxI GGCC 1 cut(s) 331
ApeKI GCWGC 1 cut(s) 692
ApoI RAATTY 1 cut(s) 139
AseI ATTAAT 1 cut(s) 500
AspS9I GGNCC 1 cut(s) 4
AsuHPI GGTGA 2 cut(s) 232, 711
AvaI CYCGRG 1 cut(s) 196
AvaII GGWCC 1 cut(s) 4
BbsI GAAGAC 1 cut(s) 225
Bbv12I GWGCWC 1 cut(s) 531
BbvI GCAGC 1 cut(s) 704
BccI CCATC 2 cut(s) 305, 724
BciT130I CCWGG 2 cut(s) 229, 657
BcuI ACTAGT 1 cut(s) 556
BfaI CTAG 2 cut(s) 101, 557
BfmI CTRYAG 1 cut(s) 327
BisI GCNGC 3 cut(s) 360, 683, 693
BlsI GCNGC 3 cut(s) 361, 684, 694
BmcAI AGTACT 1 cut(s) 194
Bme1390I CCNGG 2 cut(s) 229, 657
Bme18I GGWCC 1 cut(s) 4
BmeT110I CYCGRG 1 cut(s) 196
BmgT120I GGNCC 1 cut(s) 4
BmiI GGNNCC 1 cut(s) 6
BmrFI CCNGG 2 cut(s) 229, 657
BmsI GCATC 4 cut(s) 271, 346, 475, 491
BpiI GAAGAC 1 cut(s) 225
BplI GAGNNNNNCTC 2 cut(s) 179, 211
Bsc4I CCNNNNNNNGG 2 cut(s) 217, 608
Bse1I ACTGG 1 cut(s) 222
BseBI CCWGG 2 cut(s) 229, 657
BseGI GGATG 4 cut(s) 270, 466, 482, 514
BseLI CCNNNNNNNGG 2 cut(s) 217, 608
BseMII CTCAG 1 cut(s) 353
BseNI ACTGG 1 cut(s) 222
BseRI GAGGAG 1 cut(s) 662
BseXI GCAGC 1 cut(s) 704
BseYI CCCAGC 1 cut(s) 149
BsgI GTGCAG 1 cut(s) 711
BshFI GGCC 1 cut(s) 333
BsiHKAI GWGCWC 1 cut(s) 531
BsiHKCI CYCGRG 1 cut(s) 196
BslI CCNNNNNNNGG 2 cut(s) 217, 608
BsmI GAATGC 2 cut(s) 229, 423
BsnI GGCC 1 cut(s) 333
BsoBI CYCGRG 1 cut(s) 196
Bsp1286I GDGCHC 1 cut(s) 531
Bsp143I GATC 2 cut(s) 385, 670
BspACI CCGC 4 cut(s) 185, 360, 674, 683
BspANI GGCC 1 cut(s) 333
BspCNI CTCAG 1 cut(s) 352
BspLI GGNNCC 1 cut(s) 6
BspPI GGATC 2 cut(s) 393, 665
BspQI GCTCTTC 1 cut(s) 236
BsrI ACTGG 1 cut(s) 222
BssMI GATC 2 cut(s) 385, 670
Bst2UI CCWGG 2 cut(s) 229, 657
Bst4CI ACNGT 2 cut(s) 328, 588
Bst6I CTCTTC 1 cut(s) 236
BstC8I GCNNGC 2 cut(s) 20, 408
BstDEI CTNAG 2 cut(s) 132, 339
BstF5I GGATG 4 cut(s) 270, 466, 482, 514
BstKTI GATC 2 cut(s) 388, 673
BstMBI GATC 2 cut(s) 385, 670
BstMWI GCNNNNNNNGC 4 cut(s) 77, 463, 619, 682
BstNI CCWGG 2 cut(s) 229, 657
BstSCI CCNGG 2 cut(s) 227, 655
BstSFI CTRYAG 1 cut(s) 327
BstV1I GCAGC 1 cut(s) 704
BstV2I GAAGAC 1 cut(s) 225
BsuRI GGCC 1 cut(s) 333
BtsCI GGATG 4 cut(s) 270, 466, 482, 514
BtsI GCAGTG 1 cut(s) 29
BtsIMutI CAGTG 2 cut(s) 29, 215
Cac8I GCNNGC 2 cut(s) 20, 408
Cfr13I GGNCC 1 cut(s) 4
CsiI ACCWGGT 1 cut(s) 655
Csp6I GTAC 1 cut(s) 193
CviAII CATG 3 cut(s) 335, 416, 618
CviJI RGCY 8 cut(s) 18, 71, 93, 153, 304, 333, 410, 613
CviKI_1 RGCY 8 cut(s) 18, 71, 93, 153, 304, 333, 410, 613
CviQI GTAC 1 cut(s) 193
DdeI CTNAG 2 cut(s) 132, 339
DpnI GATC 2 cut(s) 387, 672
DpnII GATC 2 cut(s) 385, 670
Eam1104I CTCTTC 1 cut(s) 236
EarI CTCTTC 1 cut(s) 236
Eco32I GATATC 2 cut(s) 256, 517
Eco47I GGWCC 1 cut(s) 4
Eco88I CYCGRG 1 cut(s) 196
EcoRII CCWGG 2 cut(s) 227, 655
EcoRV GATATC 2 cut(s) 256, 517
FaeI CATG 3 cut(s) 338, 419, 621
FatI CATG 3 cut(s) 334, 415, 617
Fnu4HI GCNGC 3 cut(s) 360, 683, 693
FokI GGATG 4 cut(s) 257, 453, 469, 521
Fsp4HI GCNGC 3 cut(s) 360, 683, 693
FspBI CTAG 2 cut(s) 101, 557
GluI GCNGC 3 cut(s) 360, 683, 693
GsaI CCCAGC 1 cut(s) 153
HaeIII GGCC 1 cut(s) 333
Hin1II CATG 3 cut(s) 338, 419, 621
HincII GTYRAC 1 cut(s) 129
HindII GTYRAC 1 cut(s) 129
HinfI GANTC 1 cut(s) 82
HpaI GTTAAC 1 cut(s) 129
HphI GGTGA 2 cut(s) 232, 711
Hpy166II GTNNAC 1 cut(s) 129
Hpy188I TCNGA 2 cut(s) 342, 429
Hpy188III TCNNGA 1 cut(s) 470
Hpy8I GTNNAC 1 cut(s) 129
HpyCH4III ACNGT 2 cut(s) 328, 588
HpyCH4V TGCA 5 cut(s) 22, 284, 466, 539, 692
HpyF10VI GCNNNNNNNGC 4 cut(s) 77, 463, 619, 682
HpyF3I CTNAG 2 cut(s) 132, 339
Hsp92II CATG 3 cut(s) 338, 419, 621
KspAI GTTAAC 1 cut(s) 129
Kzo9I GATC 2 cut(s) 385, 670
LguI GCTCTTC 1 cut(s) 236
LmnI GCTCC 1 cut(s) 526
Lsp1109I GCAGC 1 cut(s) 704
LweI GCATC 4 cut(s) 271, 346, 475, 491
MabI ACCWGGT 1 cut(s) 655
MaeI CTAG 2 cut(s) 101, 557
MaeIII GTNAC 2 cut(s) 316, 700
MalI GATC 2 cut(s) 387, 672
MboI GATC 2 cut(s) 385, 670
MboII GAAGA 3 cut(s) 153, 225, 253
MhlI GDGCHC 1 cut(s) 531
MluCI AATT 2 cut(s) 139, 501
MmeI TCCRAC 2 cut(s) 140, 555
MnlI CCTC 7 cut(s) 48, 388, 505, 535, 630, 640, 733
MseI TTAA 5 cut(s) 128, 293, 366, 500, 534
MslI CAYNNNNRTG 1 cut(s) 534
MspR9I CCNGG 2 cut(s) 229, 657
Mva1269I GAATGC 2 cut(s) 229, 423
MvaI CCWGG 2 cut(s) 229, 657
MwoI GCNNNNNNNGC 4 cut(s) 77, 463, 619, 682
NdeII GATC 2 cut(s) 385, 670
NlaIII CATG 3 cut(s) 338, 419, 621
NlaIV GGNNCC 1 cut(s) 6
PciSI GCTCTTC 1 cut(s) 236
PctI GAATGC 2 cut(s) 229, 423
PfeI GAWTC 1 cut(s) 82
PflMI CCANNNNNTGG 2 cut(s) 217, 608
PkrI GCNGC 3 cut(s) 361, 684, 694
PshBI ATTAAT 1 cut(s) 500
Psp6I CCWGG 2 cut(s) 227, 655
PspFI CCCAGC 1 cut(s) 149
PspGI CCWGG 2 cut(s) 227, 655
PspN4I GGNNCC 1 cut(s) 6
PspPI GGNCC 1 cut(s) 4
PsrI GAACNNNNNNTAC 2 cut(s) 185, 217
RsaI GTAC 1 cut(s) 194
RsaNI GTAC 1 cut(s) 193
RseI CAYNNNNRTG 1 cut(s) 534
SapI GCTCTTC 1 cut(s) 236
SaqAI TTAA 5 cut(s) 128, 293, 366, 500, 534
SatI GCNGC 3 cut(s) 360, 683, 693
Sau3AI GATC 2 cut(s) 385, 670
Sau96I GGNCC 1 cut(s) 4
ScaI AGTACT 1 cut(s) 194
ScrFI CCNGG 2 cut(s) 229, 657
SduI GDGCHC 1 cut(s) 531
SetI ASST 5 cut(s) 20, 59, 73, 323, 658
SexAI ACCWGGT 1 cut(s) 655
SfaNI GCATC 4 cut(s) 271, 346, 475, 491
SfcI CTRYAG 1 cut(s) 327
SinI GGWCC 1 cut(s) 4
SmiMI CAYNNNNRTG 1 cut(s) 534
SpeI ACTAGT 1 cut(s) 556
Sse9I AATT 2 cut(s) 139, 501
SsiI CCGC 4 cut(s) 185, 360, 674, 683
SspMI CTAG 2 cut(s) 101, 557
StyD4I CCNGG 2 cut(s) 227, 655
TaaI ACNGT 2 cut(s) 328, 588
TasI AATT 2 cut(s) 139, 501
TatI WGTACW 1 cut(s) 192
TauI GCSGC 2 cut(s) 362, 685
TfiI GAWTC 1 cut(s) 82
Tru1I TTAA 5 cut(s) 128, 293, 366, 500, 534
Tru9I TTAA 5 cut(s) 128, 293, 366, 500, 534
TscAI CASTG 2 cut(s) 29, 222
TseI GCWGC 1 cut(s) 692
TspDTI ATGAA 3 cut(s) 152, 165, 504
TspRI CASTG 2 cut(s) 29, 222
Van91I CCANNNNNTGG 2 cut(s) 217, 608
VpaK11BI GGWCC 1 cut(s) 4
VspI ATTAAT 1 cut(s) 500
XapI RAATTY 1 cut(s) 139
XspI CTAG 2 cut(s) 101, 557
ZrmI AGTACT 1 cut(s) 194
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.