Rmu_ssc0000291.1_g000008

Glycine--tRNA ligase 1

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000291.1
Physical Location & Seq
Forward (+)
38345 .. 38810
466 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000291.1_g000008.1.cds

Sequence Viewer

Length: 381 bp
atgcagatatcacctcgccaaggtcttttgagggtccgtgaatttacccttgcggagattgagcactttgttgaccctgaagacaaatctcacccaaaattctctgatgttgcacatttggagtttcttatgttccccagggatgaacagaagcctggccattctacaaggataatctcactaggtgaagccgtatcttctaaggattctaaaattgttgacaacgaaacccttggctactttattgggagagtatacctcttcctcacttgtctgagtatagacaagaaccatttaaggttccggcagcaccttgccaatgaaatggctcactatgctcaggactattgggatgctgagattgagacttcctacggttag

Protein Analysis

126

Amino Acids

14.67

Weight (kDa)

5.58

Isoelectric Point (pI)

34.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 255
AciI CCGC 1 cut(s) 53
AcoI YGGCCR 1 cut(s) 157
AcsI RAATTY 2 cut(s) 41, 98
AcuI CTGAAG 1 cut(s) 99
AdeI CACNNNGTG 1 cut(s) 185
AfiI CCNNNNNNNGG 1 cut(s) 20
AjnI CCWGG 2 cut(s) 137, 154
Alw21I GWGCWC 1 cut(s) 66
Alw26I GTCTC 1 cut(s) 359
AoxI GGCC 1 cut(s) 157
ApeKI GCWGC 1 cut(s) 307
ApoI RAATTY 2 cut(s) 41, 98
AspS9I GGNCC 1 cut(s) 34
AsuHPI GGTGA 3 cut(s) 3, 83, 197
AvaII GGWCC 1 cut(s) 34
BalI TGGCCA 1 cut(s) 159
BbsI GAAGAC 1 cut(s) 87
Bbv12I GWGCWC 1 cut(s) 66
BbvI GCAGC 1 cut(s) 319
BceAI ACGGC 1 cut(s) 176
BciT130I CCWGG 2 cut(s) 139, 156
BcoDI GTCTC 1 cut(s) 359
BfaI CTAG 1 cut(s) 182
BisI GCNGC 1 cut(s) 308
BlsI GCNGC 1 cut(s) 309
Bme1390I CCNGG 2 cut(s) 139, 156
Bme18I GGWCC 1 cut(s) 34
BmgT120I GGNCC 1 cut(s) 34
BmiI GGNNCC 2 cut(s) 35, 302
BmrFI CCNGG 2 cut(s) 139, 156
BmsI GCATC 1 cut(s) 343
BpiI GAAGAC 1 cut(s) 87
BplI GAGNNNNNCTC 2 cut(s) 243, 275
Bpu10I CCTNAGC 1 cut(s) 339
BsaJI CCNNGG 4 cut(s) 19, 137, 138, 232
Bsc4I CCNNNNNNNGG 1 cut(s) 20
BseBI CCWGG 2 cut(s) 139, 156
BseDI CCNNGG 4 cut(s) 19, 137, 138, 232
BseGI GGATG 2 cut(s) 148, 358
BseLI CCNNNNNNNGG 1 cut(s) 20
BseMII CTCAG 3 cut(s) 266, 348, 353
BseXI GCAGC 1 cut(s) 319
BshFI GGCC 1 cut(s) 159
BsiHKAI GWGCWC 1 cut(s) 66
BsiSI CCGG 1 cut(s) 304
BslI CCNNNNNNNGG 1 cut(s) 20
BsmAI GTCTC 1 cut(s) 359
BsnI GGCC 1 cut(s) 159
Bsp1286I GDGCHC 1 cut(s) 66
BspACI CCGC 1 cut(s) 53
BspANI GGCC 1 cut(s) 159
BspCNI CTCAG 3 cut(s) 267, 349, 352
BspLI GGNNCC 2 cut(s) 35, 302
BssECI CCNNGG 4 cut(s) 19, 137, 138, 232
BssNAI GTATAC 1 cut(s) 256
BssT1I CCWWGG 2 cut(s) 19, 232
Bst1107I GTATAC 1 cut(s) 256
Bst2UI CCWGG 2 cut(s) 139, 156
Bst4CI ACNGT 1 cut(s) 377
Bst6I CTCTTC 1 cut(s) 266
BstDEI CTNAG 4 cut(s) 201, 275, 339, 357
BstENI CCTNNNNNAGG 1 cut(s) 18
BstF5I GGATG 2 cut(s) 148, 358
BstMAI GTCTC 1 cut(s) 359
BstMWI GCNNNNNNNGC 1 cut(s) 335
BstNI CCWGG 2 cut(s) 139, 156
BstSCI CCNGG 2 cut(s) 137, 154
BstV1I GCAGC 1 cut(s) 319
BstV2I GAAGAC 1 cut(s) 87
BstXI CCANNNNNNTGG 1 cut(s) 325
BstZ17I GTATAC 1 cut(s) 256
BsuRI GGCC 1 cut(s) 159
BtsCI GGATG 2 cut(s) 148, 358
Cfr13I GGNCC 1 cut(s) 34
CviJI RGCY 5 cut(s) 154, 159, 191, 237, 329
CviKI_1 RGCY 5 cut(s) 154, 159, 191, 237, 329
DdeI CTNAG 4 cut(s) 201, 275, 339, 357
DraIII CACNNNGTG 1 cut(s) 185
EaeI YGGCCR 1 cut(s) 157
Eam1104I CTCTTC 1 cut(s) 266
EarI CTCTTC 1 cut(s) 266
Eco130I CCWWGG 2 cut(s) 19, 232
Eco32I GATATC 1 cut(s) 9
Eco47I GGWCC 1 cut(s) 34
Eco57I CTGAAG 1 cut(s) 99
EcoNI CCTNNNNNAGG 1 cut(s) 18
EcoRII CCWGG 2 cut(s) 137, 154
EcoRV GATATC 1 cut(s) 9
EcoT14I CCWWGG 2 cut(s) 19, 232
ErhI CCWWGG 2 cut(s) 19, 232
FaiI YATR 4 cut(s) 131, 256, 281, 336
FblI GTMKAC 1 cut(s) 255
Fnu4HI GCNGC 1 cut(s) 308
FokI GGATG 2 cut(s) 155, 365
Fsp4HI GCNGC 1 cut(s) 308
FspBI CTAG 1 cut(s) 182
GluI GCNGC 1 cut(s) 308
HaeIII GGCC 1 cut(s) 159
HapII CCGG 1 cut(s) 304
HincII GTYRAC 2 cut(s) 73, 220
HindII GTYRAC 2 cut(s) 73, 220
HinfI GANTC 1 cut(s) 206
HpaII CCGG 1 cut(s) 304
HphI GGTGA 3 cut(s) 3, 83, 197
Hpy166II GTNNAC 3 cut(s) 73, 220, 256
Hpy188I TCNGA 2 cut(s) 106, 276
Hpy188III TCNNGA 1 cut(s) 341
Hpy8I GTNNAC 3 cut(s) 73, 220, 256
HpyCH4III ACNGT 1 cut(s) 377
HpyCH4V TGCA 2 cut(s) 4, 113
HpyF10VI GCNNNNNNNGC 1 cut(s) 335
HpyF3I CTNAG 4 cut(s) 201, 275, 339, 357
LpnPI CCDG 7 cut(s) 90, 124, 141, 151, 168, 317, 326
Lsp1109I GCAGC 1 cut(s) 319
LweI GCATC 1 cut(s) 343
MaeI CTAG 1 cut(s) 182
MboII GAAGA 3 cut(s) 92, 189, 253
MhlI GDGCHC 1 cut(s) 66
MlsI TGGCCA 1 cut(s) 159
MluCI AATT 3 cut(s) 41, 98, 213
MluNI TGGCCA 1 cut(s) 159
MnlI CCTC 4 cut(s) 24, 24, 269, 275
Mox20I TGGCCA 1 cut(s) 159
MscI TGGCCA 1 cut(s) 159
MseI TTAA 1 cut(s) 296
Msp20I TGGCCA 1 cut(s) 159
MspI CCGG 1 cut(s) 304
MspR9I CCNGG 2 cut(s) 139, 156
MvaI CCWGG 2 cut(s) 139, 156
MwoI GCNNNNNNNGC 1 cut(s) 335
NlaIV GGNNCC 2 cut(s) 35, 302
PasI CCCWGGG 1 cut(s) 138
PfeI GAWTC 1 cut(s) 206
PkrI GCNGC 1 cut(s) 309
Psp6I CCWGG 2 cut(s) 137, 154
PspGI CCWGG 2 cut(s) 137, 154
PspN4I GGNNCC 2 cut(s) 35, 302
PspPI GGNCC 1 cut(s) 34
SaqAI TTAA 1 cut(s) 296
SatI GCNGC 1 cut(s) 308
Sau96I GGNCC 1 cut(s) 34
ScrFI CCNGG 2 cut(s) 139, 156
SduI GDGCHC 1 cut(s) 66
SetI ASST 6 cut(s) 16, 25, 187, 261, 302, 315
SfaNI GCATC 1 cut(s) 343
SinI GGWCC 1 cut(s) 34
Sse9I AATT 3 cut(s) 41, 98, 213
SsiI CCGC 1 cut(s) 53
SspMI CTAG 1 cut(s) 182
StyD4I CCNGG 2 cut(s) 137, 154
StyI CCWWGG 2 cut(s) 19, 232
TaaI ACNGT 1 cut(s) 377
TasI AATT 3 cut(s) 41, 98, 213
TfiI GAWTC 1 cut(s) 206
Tru1I TTAA 1 cut(s) 296
Tru9I TTAA 1 cut(s) 296
TseI GCWGC 1 cut(s) 307
TspDTI ATGAA 2 cut(s) 159, 336
TspGWI ACGGA 1 cut(s) 26
VpaK11BI GGWCC 1 cut(s) 34
XagI CCTNNNNNAGG 1 cut(s) 18
XapI RAATTY 2 cut(s) 41, 98
XmiI GTMKAC 1 cut(s) 255
XspI CTAG 1 cut(s) 182
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.