Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000435.1

Orthogroup ID

OG0003601

Physical Location & Seq

Genomic Coordinates Reverse (-)

17736 .. 26289

Gene Structure 8554 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000435.1_g000004.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 3174 bp

atgtccaaagaaaacggtcaaatccacggcggaggcggactcacggaggagcaaagaaaccgaatttctcggaattacagagccgccaaggctcttctcgaccgtaaacgccctcgtaacgacgccgtttcgcctgatgcgcacttccctcacagcaaattccgaactcctactcagcttaatcggcgagctcctcttgctgagctaacggtaaatactccatctccattttctgtgaatcgctgcaactcagcagtttctgaatccagcaccggttcatattgtgagagctcaagctcagtcattactcggattgaagattccttcactactccgatcaggcaaccgcagttttgtactccagttgattctttctcggcagcgaccggaattctggacgacgacgatgatttcgatgagagtgttttgcaggagattgacgctttgatcgagcagaaaactctacaagtacaagttcagcgtgatgttaatgtgaatggttctgtggtggcgcgtgtgattagtggcggtggaggtgattctactgaccatggattaccgagcatgccggatgagtacttgaagtatttacagtctctcaatgaccggcaacgcgaagcagcttgtagtgacattgcaacaccattgatgattgctgcaggacctggaagtggaaagacctcaactatggttgggcgtgttctaatgctgcttaatgaggggattagtgcatccaacattctagcaatgactttcactatagcagcagcttccgagatgagagagcgcattgcaaaggtggctgggaaagcagcggcaaaagaacttacaatcagcacctttcattcattttcattgcagctttgtcgattacatgcagagaaacttgagcgcacaccagagttcttaatatatggacatggacaacagagaagagcaattattgaagctgtgcggttatcagaaaatggaaagggtaggccgaaatataatgtcggcatggacagtgaagagtctaatggtttgacttctcctcatcactttaaggatgcgtcaaagaaatggctgaaatttgtaactcaggccaaagcttctggaaagactcctgcagaatacagtaaaatgggcaatgagataggggctgagattcttggaaactacaatgatatcttaaaatcttgcaatgccttggactaccatgacttgattagctgctctgtgaagctgctcacggattttcctgaagtgttaaaggagagccaggattcatggaaagccattgtcatagatgagtttcaagacacaagtgctatgcaatatagtcttctgcggattcttgcctctcacaaccacataaccattgttggagatgatgatcaatcgattttcagtttcaatggagcagacatttctggatttgattccttccgtaaggatttccccatttacaaagagattagactcaataaaaactatcggtctacacgctatattgtggaagctgcatcatgtgtcataaaaaacaataagaagagatgtcagctaaagaatgttgacaccgacaactcttctggatccaagattgttatcaaagaatgccacaatgaggatgcacaatgtgcctttgttgttgacaagatcttggagaccacatctaaccaatcaaatgtaaagtgctcattcggaaacatcgcaatcctttaccggaggcaggtatcaggaaaagtcttccaaacagcctttcgtgaaaggaaaataccttttaatgttcatggagtagcagtttatcggaagaaggtagttagagccattattgctatgcttagaacaactttgcctggttgtgatgatggatcatatcgccgagtcttcaaggctttacttccttttgagaaagaggaaaagaagaaggtgattgattacattgacaaaatttctaccgccagaaaattcagcttcatatcagctgctggtgaaattttcagtgcaaaagtttctgggaacttgaagaggcctcagcttactcaaggacgcaaggtgctgttgacattagagatgatttcaaaactcgttcacaggaaataccttctggagcagcgtgctatcgtcgatgttgatggtgggaagttgctaaatgaagacaatgacatgagatctgttcttcagtacctactggatgatatatctgattttctatccactcattttgctgcggcagaaggggagagagaagttgtagaaggagataaaggatgtcttaatttactcaaagctttcattgactacatatctgaacgggagagtgaaaactttcgctcccgaagacatgacaatgaaacttctgttaccttaactaccatccatcaggtaaatgaatgtgagataccgttgttgcatgaattcaatggtagtgcaaaagagaatgggacgtccattgaggaggaaagacgcctattatatgttgcaatgactcgtgctcgaacaaaacttttcattctttatgttttgacggattccaattggcagatgcttcaaccttcacggtttctcagagaaattccaaatcatcttcgagaagaacaggctgacatagaaaagcaagatttacagtcaaagcatcatgacatttcaaaaggaactactgggttgttggctgatctacgaccaaacattcgaccctctgaagaagatgtggtgcagaatgattttcaccctagcaaaattgatgaagcttctacagagttgactgaatttgtggaggcaaactttggaactggtttcttaaaaagattctgtgtggacgagagatcaattatctcacatttatttaatgagtgggctaagaagcaagcatttcaacatcctaagaggttgcttgacaaggtgggttttgtaatagatgaacgtctgcgagtcaagaactacaaacacaaggatgtgttgcgcttgctgaagtcttacttgaaaggtgacgatgcatttcaatatgcggaatacgttttgagatggcagaaaatacctgctgatcaacgtgctcatatgatgcgggaaaagcaggagcatttccagaagttaaggattgagaactcaatgggttcatctgcaccaacaccgaaacaggttgctaagattcatcactcgattatttcctttgtggacacagtggtctcttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003678 GO:0003824 GO:0004386 GO:0006139 GO:0006259 GO:0006310 GO:0006725 GO:0006807 GO:0006996 GO:0008150 GO:0008152 GO:0009987 GO:0016043 GO:0016462 GO:0016787 GO:0016817 GO:0016818 GO:0017111 GO:0032392 GO:0032508 GO:0034641 GO:0036292 GO:0043138 GO:0043170 GO:0044237 GO:0044238 GO:0044260 GO:0046483 GO:0051276 GO:0071103 GO:0071704 GO:0071840 GO:0090304 GO:0140097 GO:1901360

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

UvrD-helicase UvrD_C

Protein Analysis

1057

Amino Acids

119.28

Weight (kDa)

8.25

Isoelectric Point (pI)

41.95

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003601)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G25120
fragaria_vesca	FvH4_7g26710 FvH4_7g26710 FvH4_7g26710 FvH4_7g26710
malus_domestica	MD07G1241600.v1.1 MD07G1241700.v1.1 MD07G1243100.v1.1 MD07G1243600.v1.1 MD07G1244100.v1.1 MD07G1244200.v1.1 MD07G1244300.v1.1 MD07G1244800.v1.1 MD07G1245200.v1.1 MD07G1245700.v1.1 MD07G1245800.v1.1
prunus_persica	Prupe.2G270600_v2.0.a1 Prupe.2G270600_v2.0.a1
pyrus_communis	pycom07g21810 pycom07g21980
rosa_chinensis	RchiOBHm_Chr1g0373301
rosa_laevigata	RLG00000001620 RLG00000006922 RLG00000035899
rosa_multiflora	Rmu_ssc0000435.1_g000004
rosa_roxburghii	Rroxscaffold_4G00284280
rosa_rugosa	Rorug01G0376900
rosa_samantha	Rh1AG385900 Rh1BG350100 Rh1CG363200 Rh1DG380900 Rh3CG316100 Rh5CG053300 Rh5DG386500
rosa_wichuraiana	Rw1G034900

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	3164
AatII	GACGTC	1 cut(s)	2432
Acc16I	TGCGCA	1 cut(s)	141
Acc36I	ACCTGC	2 cut(s)	1702, 3028
AccI	GTMKAC	1 cut(s)	1481
AccII	CGCG	2 cut(s)	514, 615
AclWI	GGATC	3 cut(s)	1569, 1582, 1861
AcuI	CTGAAG	4 cut(s)	1263, 2147, 2703, 2972
AcyI	GRCGYC	3 cut(s)	123, 2429, 2449
AdeI	CACNNNGTG	1 cut(s)	1619
AfaI	GTAC	4 cut(s)	358, 471, 578, 2168
AfiI	CCNNNNNNNGG	3 cut(s)	671, 1606, 1711
AgeI	ACCGGT	1 cut(s)	272
AjnI	CCWGG	3 cut(s)	664, 1260, 1837
AjuI	GAANNNNNNNTTGG	2 cut(s)	1725, 1757
Alw21I	GWGCWC	5 cut(s)	193, 293, 1679, 2479, 3037
Alw26I	GTCTC	2 cut(s)	600, 1640
AlwI	GGATC	3 cut(s)	1569, 1582, 1861
AlwNI	CAGNNNCTG	3 cut(s)	260, 665, 1970
AoxI	GGCC	3 cut(s)	980, 1083, 2012
ArsI	GACNNNNNNTTYG	4 cut(s)	395, 427, 2655, 2687
AsiGI	ACCGGT	1 cut(s)	272
Asp700I	GAANNNNTTC	1 cut(s)	2310
AspLEI	GCGC	5 cut(s)	142, 514, 789, 894, 2946
AspS9I	GGNCC	1 cut(s)	662
AsuHPI	GGTGA	5 cut(s)	548, 1924, 1985, 2702, 2981
AvaII	GGWCC	1 cut(s)	662
BaeI	ACNNNNGTAYC	2 cut(s)	2375, 2408
BamHI	GGATCC	1 cut(s)	1574
BanII	GRGCYC	2 cut(s)	193, 293
BauI	CACGAG	1 cut(s)	2472
BbsI	GAAGAC	5 cut(s)	1316, 1720, 1861, 2145, 2329
Bbv12I	GWGCWC	5 cut(s)	193, 293, 1679, 2479, 3037
BbvCI	CCTCAGC	1 cut(s)	2016
BccI	CCATC	6 cut(s)	229, 1844, 2111, 2366, 2370, 3000
BceAI	ACGGC	2 cut(s)	43, 110
BcgI	CGANNNNNNTGC	2 cut(s)	848, 882
BciT130I	CCWGG	3 cut(s)	666, 1262, 1839
BclI	TGATCA	2 cut(s)	1375, 3025
BcoDI	GTCTC	2 cut(s)	600, 1640
BfaI	CTAG	2 cut(s)	743, 2715
BfmI	CTRYAG	4 cut(s)	657, 759, 1107, 2736
BfuAI	ACCTGC	2 cut(s)	1702, 3028
BglI	GCCNNNNNGGC	1 cut(s)	89
BglII	AGATCT	2 cut(s)	1638, 2153
BlpI	GCTNAGC	1 cut(s)	201
BmcAI	AGTACT	1 cut(s)	578
Bme1390I	CCNGG	3 cut(s)	666, 1262, 1839
Bme18I	GGWCC	1 cut(s)	662
BmgT120I	GGNCC	1 cut(s)	662
BmiI	GGNNCC	1 cut(s)	1576
BmrFI	CCNGG	3 cut(s)	666, 1262, 1839
BmrI	ACTGGG	1 cut(s)	2652
BmsI	GCATC	9 cut(s)	127, 740, 1039, 1514, 1600, 2517, 2626, 2965, 3033
BmuI	ACTGGG	1 cut(s)	2652
BpiI	GAAGAC	5 cut(s)	1316, 1720, 1861, 2145, 2329
BplI	GAGNNNNNCTC	2 cut(s)	24, 56
BpmI	CTGGAG	2 cut(s)	345, 2111
Bpu10I	CCTNAGC	1 cut(s)	2016
Bpu1102I	GCTNAGC	1 cut(s)	201
BpuEI	CTTGAG	3 cut(s)	277, 908, 2010
Bsa29I	ATCGAT	1 cut(s)	1382
BsaBI	GATNNNNATC	2 cut(s)	1374, 1586
BsaHI	GRCGYC	3 cut(s)	123, 2429, 2449
BsaI	GGTCTC	1 cut(s)	1640
BsaJI	CCNNGG	4 cut(s)	25, 87, 550, 1188
BsaWI	WCCGGW	3 cut(s)	272, 386, 1704
BsaXI	ACNNNNNCTCC	6 cut(s)	208, 238, 1767, 1797, 2300, 2330
Bsc4I	CCNNNNNNNGG	3 cut(s)	671, 1606, 1711
Bse118I	RCCGGY	2 cut(s)	272, 606
Bse1I	ACTGG	4 cut(s)	362, 2178, 2647, 2779
Bse3DI	GCAATG	7 cut(s)	633, 753, 789, 854, 1135, 1189, 2472
Bse8I	GATNNNNATC	2 cut(s)	1374, 1586
BseBI	CCWGG	3 cut(s)	666, 1262, 1839
BseCI	ATCGAT	1 cut(s)	1382
BseDI	CCNNGG	4 cut(s)	25, 87, 550, 1188
BseGI	GGATG	9 cut(s)	577, 731, 1054, 1615, 2182, 2258, 2358, 2860, 2941
BseJI	GATNNNNATC	2 cut(s)	1374, 1586
BseLI	CCNNNNNNNGG	3 cut(s)	671, 1606, 1711
BseMI	GCAATG	7 cut(s)	633, 753, 789, 854, 1135, 1189, 2472
BseMII	CTCAG	8 cut(s)	188, 192, 264, 312, 1094, 1134, 2030, 2563
BseNI	ACTGG	4 cut(s)	362, 2178, 2647, 2779
BseRI	GAGGAG	4 cut(s)	62, 183, 1023, 2453
BseYI	CCCAGC	1 cut(s)	803
BsgI	GTGCAG	2 cut(s)	2717, 3087
Bsh1236I	CGCG	2 cut(s)	514, 615
Bsh1285I	CGRYCG	2 cut(s)	103, 387
BshFI	GGCC	3 cut(s)	982, 1085, 2014
BshTI	ACCGGT	1 cut(s)	272
BshVI	ATCGAT	1 cut(s)	1382
BsiEI	CGRYCG	2 cut(s)	103, 387
BsiHKAI	GWGCWC	5 cut(s)	193, 293, 1679, 2479, 3037
BsiSI	CCGG	5 cut(s)	273, 387, 569, 607, 1705
BslFI	GGGAC	1 cut(s)	2440
BslI	CCNNNNNNNGG	3 cut(s)	671, 1606, 1711
BsmAI	GTCTC	2 cut(s)	600, 1640
BsmFI	GGGAC	1 cut(s)	2440
BsmI	GAATGC	1 cut(s)	1601
BsnI	GGCC	3 cut(s)	982, 1085, 2014
Bso31I	GGTCTC	1 cut(s)	1640
Bsp1286I	GDGCHC	5 cut(s)	193, 293, 1679, 2479, 3037
Bsp1720I	GCTNAGC	1 cut(s)	201
Bsp19I	CCATGG	1 cut(s)	550
BspANI	GGCC	3 cut(s)	982, 1085, 2014
BspCNI	CTCAG	8 cut(s)	187, 193, 263, 311, 1093, 1135, 2029, 2562
BspDI	ATCGAT	1 cut(s)	1382
BspFNI	CGCG	2 cut(s)	514, 615
BspHI	TCATGA	1 cut(s)	2620
BspLI	GGNNCC	1 cut(s)	1576
BspMAI	CTGCAG	2 cut(s)	661, 1111
BspMI	ACCTGC	2 cut(s)	1702, 3028
BspPI	GGATC	3 cut(s)	1569, 1582, 1861
BspQI	GCTCTTC	2 cut(s)	99, 928
BspTNI	GGTCTC	1 cut(s)	1640
BsrDI	GCAATG	7 cut(s)	633, 753, 789, 854, 1135, 1189, 2472
BsrFI	RCCGGY	2 cut(s)	272, 606
BsrI	ACTGG	4 cut(s)	362, 2178, 2647, 2779
BssAI	RCCGGY	2 cut(s)	272, 606
BssECI	CCNNGG	4 cut(s)	25, 87, 550, 1188
BssNI	GRCGYC	3 cut(s)	123, 2429, 2449
BssSI	CACGAG	1 cut(s)	2472
BssT1I	CCWWGG	3 cut(s)	87, 550, 1188
Bst2BI	CACGAG	1 cut(s)	2472
Bst2UI	CCWGG	3 cut(s)	666, 1262, 1839
Bst6I	CTCTTC	6 cut(s)	99, 928, 1005, 1526, 1573, 2003
BstACI	GRCGYC	3 cut(s)	123, 2429, 2449
BstAPI	GCANNNNNTGC	1 cut(s)	1619
BstC8I	GCNNGC	5 cut(s)	189, 566, 2100, 2850, 2948
BstDSI	CCRYGG	2 cut(s)	25, 550
BstF5I	GGATG	9 cut(s)	577, 731, 1054, 1615, 2182, 2258, 2358, 2860, 2941
BstFNI	CGCG	2 cut(s)	514, 615
BstHHI	GCGC	5 cut(s)	142, 514, 789, 894, 2946
BstMAI	GTCTC	2 cut(s)	600, 1640
BstMCI	CGRYCG	2 cut(s)	103, 387
BstMWI	GCNNNNNNNGC	9 cut(s)	89, 139, 184, 197, 800, 809, 1619, 1814, 3052
BstNI	CCWGG	3 cut(s)	666, 1262, 1839
BstNSI	RCATGY	2 cut(s)	568, 878
BstSCI	CCNGG	3 cut(s)	664, 1260, 1837
BstSFI	CTRYAG	4 cut(s)	657, 759, 1107, 2736
BstUI	CGCG	2 cut(s)	514, 615
BstV2I	GAAGAC	5 cut(s)	1316, 1720, 1861, 2145, 2329
BstX2I	RGATCY	3 cut(s)	1574, 1638, 2153
BstYI	RGATCY	3 cut(s)	1574, 1638, 2153
Bsu15I	ATCGAT	1 cut(s)	1382
BsuRI	GGCC	3 cut(s)	982, 1085, 2014
BsuTUI	ATCGAT	1 cut(s)	1382
BtgI	CCRYGG	2 cut(s)	25, 550
BtgZI	GCGATG	1 cut(s)	1675
BtsCI	GGATG	9 cut(s)	577, 731, 1054, 1615, 2182, 2258, 2358, 2860, 2941
BtsIMutI	CAGTG	3 cut(s)	1012, 1990, 3168
BveI	ACCTGC	2 cut(s)	1702, 3028
Cac8I	GCNNGC	5 cut(s)	189, 566, 2100, 2850, 2948
CaiI	CAGNNNCTG	3 cut(s)	260, 665, 1970
CciI	TCATGA	1 cut(s)	2620
CfoI	GCGC	5 cut(s)	142, 514, 789, 894, 2946
Cfr10I	RCCGGY	2 cut(s)	272, 606
Cfr13I	GGNCC	1 cut(s)	662
ClaI	ATCGAT	1 cut(s)	1382
CseI	GACGC	5 cut(s)	131, 449, 1041, 2040, 2457
Csp6I	GTAC	4 cut(s)	357, 470, 577, 2167
CspAI	ACCGGT	1 cut(s)	272
CspCI	CAANNNNNGTGG	2 cut(s)	2188, 2223
CviQI	GTAC	4 cut(s)	357, 470, 577, 2167
DraIII	CACNNNGTG	1 cut(s)	1619
DrdI	GACNNNNNNGTC	1 cut(s)	3164
DseDI	GACNNNNNNGTC	1 cut(s)	3164
Eam1104I	CTCTTC	6 cut(s)	99, 928, 1005, 1526, 1573, 2003
EarI	CTCTTC	6 cut(s)	99, 928, 1005, 1526, 1573, 2003
EciI	GGCGGA	2 cut(s)	45, 51
Ecl136II	GAGCTC	2 cut(s)	191, 291
Eco130I	CCWWGG	3 cut(s)	87, 550, 1188
Eco147I	AGGCCT	1 cut(s)	2014
Eco24I	GRGCYC	2 cut(s)	193, 293
Eco31I	GGTCTC	1 cut(s)	1640
Eco32I	GATATC	1 cut(s)	1168
Eco47I	GGWCC	1 cut(s)	662
Eco53kI	GAGCTC	2 cut(s)	191, 291
Eco57I	CTGAAG	4 cut(s)	1263, 2147, 2703, 2972
EcoICRI	GAGCTC	2 cut(s)	191, 291
EcoO109I	RGGNCCY	1 cut(s)	662
EcoRI	GAATTC	2 cut(s)	390, 2399
EcoRII	CCWGG	3 cut(s)	664, 1260, 1837
EcoRV	GATATC	1 cut(s)	1168
EcoT14I	CCWWGG	3 cut(s)	87, 550, 1188
EcoT22I	ATGCAT	1 cut(s)	2980
EcoT38I	GRGCYC	2 cut(s)	193, 293
ErhI	CCWWGG	3 cut(s)	87, 550, 1188
FalI	AAGNNNNNCTT	4 cut(s)	2241, 2273, 2945, 2977
FaqI	GGGAC	1 cut(s)	2440
FauI	CCCGC	1 cut(s)	3039
FauNDI	CATATG	1 cut(s)	3039
FbaI	TGATCA	2 cut(s)	1375, 3025
FblI	GTMKAC	1 cut(s)	1481
FokI	GGATG	9 cut(s)	584, 718, 1061, 1622, 2189, 2265, 2345, 2847, 2948
FriOI	GRGCYC	2 cut(s)	193, 293
FspAI	RTGCGCAY	1 cut(s)	141
FspBI	CTAG	2 cut(s)	743, 2715
FspI	TGCGCA	1 cut(s)	141
GlaI	GCGC	5 cut(s)	141, 513, 788, 893, 2945
GsaI	CCCAGC	1 cut(s)	807
GsuI	CTGGAG	2 cut(s)	345, 2111
HaeIII	GGCC	3 cut(s)	982, 1085, 2014
HapII	CCGG	5 cut(s)	273, 387, 569, 607, 1705
HgaI	GACGC	5 cut(s)	131, 449, 1041, 2040, 2457
HhaI	GCGC	5 cut(s)	142, 514, 789, 894, 2946
Hin1I	GRCGYC	3 cut(s)	123, 2429, 2449
Hin6I	GCGC	5 cut(s)	140, 512, 787, 892, 2944
HinP1I	GCGC	5 cut(s)	140, 512, 787, 892, 2944
HincII	GTYRAC	4 cut(s)	1555, 1633, 2046, 2745
HindII	GTYRAC	4 cut(s)	1555, 1633, 2046, 2745
HindIII	AAGCTT	3 cut(s)	1089, 2271, 2730
HpaII	CCGG	5 cut(s)	273, 387, 569, 607, 1705
HphI	GGTGA	5 cut(s)	548, 1924, 1985, 2702, 2981
Hpy166II	GTNNAC	9 cut(s)	107, 1482, 1555, 1633, 2046, 2074, 2745, 2800, 3157
Hpy8I	GTNNAC	9 cut(s)	107, 1482, 1555, 1633, 2046, 2074, 2745, 2800, 3157
Hpy99I	CGWCG	4 cut(s)	125, 404, 407, 2111
HpyAV	CCTTC	8 cut(s)	334, 1435, 1789, 1903, 2096, 2213, 2234, 2547
HpyCH4IV	ACGT	4 cut(s)	2429, 2905, 2997, 3031
HpyF10VI	GCNNNNNNNGC	9 cut(s)	89, 139, 184, 197, 800, 809, 1619, 1814, 3052
HpySE526I	ACGT	4 cut(s)	2429, 2905, 2997, 3031
Hsp92I	GRCGYC	3 cut(s)	123, 2429, 2449
HspAI	GCGC	5 cut(s)	140, 512, 787, 892, 2944
Ksp22I	TGATCA	2 cut(s)	1375, 3025
LguI	GCTCTTC	2 cut(s)	99, 928
LmnI	GCTCC	6 cut(s)	49, 196, 1400, 2092, 2321, 3058
LweI	GCATC	9 cut(s)	127, 740, 1039, 1514, 1600, 2517, 2626, 2965, 3033
MaeI	CTAG	2 cut(s)	743, 2715
MaeII	ACGT	4 cut(s)	2429, 2905, 2997, 3031
MaeIII	GTNAC	5 cut(s)	116, 629, 1075, 2344, 2969
MfeI	CAATTG	1 cut(s)	2518
MflI	RGATCY	3 cut(s)	1574, 1638, 2153
MhlI	GDGCHC	5 cut(s)	193, 293, 1679, 2479, 3037
MlyI	GAGTC	7 cut(s)	33, 1022, 1096, 1455, 1875, 2464, 2922
MmeI	TCCRAC	2 cut(s)	759, 1345
Mph1103I	ATGCAT	1 cut(s)	2980
MroXI	GAANNNNTTC	1 cut(s)	2310
MslI	CAYNNNNRTG	2 cut(s)	2331, 2934
MspA1I	CMGCKG	2 cut(s)	815, 1967
MspI	CCGG	5 cut(s)	273, 387, 569, 607, 1705
MspR9I	CCNGG	3 cut(s)	666, 1262, 1839
MunI	CAATTG	1 cut(s)	2518
Mva1269I	GAATGC	1 cut(s)	1601
MvaI	CCWGG	3 cut(s)	666, 1262, 1839
MvnI	CGCG	2 cut(s)	514, 615
MwoI	GCNNNNNNNGC	9 cut(s)	89, 139, 184, 197, 800, 809, 1619, 1814, 3052
NcoI	CCATGG	1 cut(s)	550
NdeI	CATATG	1 cut(s)	3039
NlaIV	GGNNCC	1 cut(s)	1576
NmeAIII	GCCGAG	2 cut(s)	356, 1889
NmuCI	GTSAC	2 cut(s)	629, 2969
NsbI	TGCGCA	1 cut(s)	141
NsiI	ATGCAT	1 cut(s)	2980
NspI	RCATGY	2 cut(s)	568, 878
PaeI	GCATGC	1 cut(s)	568
PagI	TCATGA	1 cut(s)	2620
PceI	AGGCCT	1 cut(s)	2014
PciSI	GCTCTTC	2 cut(s)	99, 928
PcsI	WCGNNNNNNNCGW	2 cut(s)	411, 447
PctI	GAATGC	1 cut(s)	1601
PdmI	GAANNNNTTC	1 cut(s)	2310
PinAI	ACCGGT	1 cut(s)	272
PleI	GAGTC	7 cut(s)	33, 1021, 1096, 1455, 1874, 2464, 2921
PpsI	GAGTC	7 cut(s)	33, 1021, 1096, 1455, 1874, 2464, 2921
PpuMI	RGGWCCY	1 cut(s)	662
Psp124BI	GAGCTC	2 cut(s)	193, 293
Psp5II	RGGWCCY	1 cut(s)	662
Psp6I	CCWGG	3 cut(s)	664, 1260, 1837
PspFI	CCCAGC	1 cut(s)	803
PspGI	CCWGG	3 cut(s)	664, 1260, 1837
PspN4I	GGNNCC	1 cut(s)	1576
PspPI	GGNCC	1 cut(s)	662
PspPPI	RGGWCCY	1 cut(s)	662
PstI	CTGCAG	2 cut(s)	661, 1111
PstNI	CAGNNNCTG	3 cut(s)	260, 665, 1970
PsuI	RGATCY	3 cut(s)	1574, 1638, 2153
PvuII	CAGCTG	1 cut(s)	1967
RsaI	GTAC	4 cut(s)	358, 471, 578, 2168
RsaNI	GTAC	4 cut(s)	357, 470, 577, 2167
RseI	CAYNNNNRTG	2 cut(s)	2331, 2934
SacI	GAGCTC	2 cut(s)	193, 293
SapI	GCTCTTC	2 cut(s)	99, 928
Sau96I	GGNCC	1 cut(s)	662
ScaI	AGTACT	1 cut(s)	578
SchI	GAGTC	7 cut(s)	33, 1022, 1096, 1455, 1875, 2464, 2922
ScrFI	CCNGG	3 cut(s)	666, 1262, 1839
SduI	GDGCHC	5 cut(s)	193, 293, 1679, 2479, 3037
SfaNI	GCATC	9 cut(s)	127, 740, 1039, 1514, 1600, 2517, 2626, 2965, 3033
SfcI	CTRYAG	4 cut(s)	657, 759, 1107, 2736
SinI	GGWCC	1 cut(s)	662
SmiMI	CAYNNNNRTG	2 cut(s)	2331, 2934
SmlI	CTYRAG	3 cut(s)	292, 887, 2025
SmoI	CTYRAG	3 cut(s)	292, 887, 2025
SphI	GCATGC	1 cut(s)	568
SseBI	AGGCCT	1 cut(s)	2014
SspMI	CTAG	2 cut(s)	743, 2715
SstI	GAGCTC	2 cut(s)	193, 293
StuI	AGGCCT	1 cut(s)	2014
StyD4I	CCNGG	3 cut(s)	664, 1260, 1837
StyI	CCWWGG	3 cut(s)	87, 550, 1188
TaiI	ACGT	4 cut(s)	2432, 2908, 3000, 3034
TaqII	GACCGA	1 cut(s)	1467
TatI	WGTACW	3 cut(s)	356, 469, 576
TauI	GCSGC	3 cut(s)	86, 818, 2216
TscAI	CASTG	3 cut(s)	1012, 1990, 3168
TseFI	GTSAC	2 cut(s)	629, 2969
Tsp45I	GTSAC	2 cut(s)	629, 2969
TspGWI	ACGGA	4 cut(s)	59, 1247, 1418, 2525
TspRI	CASTG	3 cut(s)	1012, 1990, 3168
VpaK11BI	GGWCC	1 cut(s)	662
XceI	RCATGY	2 cut(s)	568, 878
XmiI	GTMKAC	1 cut(s)	1481
XmnI	GAANNNNTTC	1 cut(s)	2310
XspI	CTAG	2 cut(s)	743, 2715
ZraI	GACGTC	1 cut(s)	2430
ZrmI	AGTACT	1 cut(s)	578
Zsp2I	ATGCAT	1 cut(s)	2980

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.