Rroxscaffold_1G00024980

Protein of unknown function (DUF3675)

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
31103971 .. 31105232
1262 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00024980.1

Sequence Viewer

Length: 234 bp
ATGGATCATGAATTGGTCATAGAAGGTGCGTGTGGATTAGAAGAATCGTCATGTGCTGAGTGTAAAATATGCCAGGAGGAGGACGTCATTGACAAAATGGACGCTCCGTGTTATTGCAACGGCACTTTAAAGATTACTGGTCTTTACCTTCTTTTCATTGCGGGTGAACTATCCGGGGCTTCCTCGATCCCTTTCACCCTGGTCGCTCCAAGAGCCCCGGCCACTCATGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

77

Amino Acids

8.22

Weight (kDa)

4.35

Isoelectric Point (pI)

53.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 87
AciI CCGC 1 cut(s) 161
AclWI GGATC 2 cut(s) 12, 181
AcoI YGGCCR 1 cut(s) 219
AcyI GRCGYC 1 cut(s) 84
AfiI CCNNNNNNNGG 1 cut(s) 79
AjnI CCWGG 2 cut(s) 72, 198
AlwI GGATC 2 cut(s) 12, 181
AoxI GGCC 1 cut(s) 219
AsuC2I CCSGG 2 cut(s) 175, 218
AsuHPI GGTGA 2 cut(s) 176, 187
BanII GRGCYC 1 cut(s) 217
BceAI ACGGC 1 cut(s) 136
BciT130I CCWGG 2 cut(s) 74, 200
BcnI CCSGG 2 cut(s) 175, 218
Bme1390I CCNGG 4 cut(s) 74, 175, 200, 218
BmrFI CCNGG 4 cut(s) 74, 175, 200, 218
BpuMI CCSGG 2 cut(s) 175, 218
BsaHI GRCGYC 1 cut(s) 84
BsaJI CCNNGG 3 cut(s) 174, 198, 216
Bsc4I CCNNNNNNNGG 1 cut(s) 79
Bse1I ACTGG 1 cut(s) 142
Bse3DI GCAATG 1 cut(s) 156
BseBI CCWGG 2 cut(s) 74, 200
BseDI CCNNGG 3 cut(s) 174, 198, 216
BseLI CCNNNNNNNGG 1 cut(s) 79
BseMI GCAATG 1 cut(s) 156
BseMII CTCAG 1 cut(s) 48
BseNI ACTGG 1 cut(s) 142
BseRI GAGGAG 1 cut(s) 92
BshFI GGCC 1 cut(s) 221
BsiSI CCGG 2 cut(s) 174, 218
BslI CCNNNNNNNGG 1 cut(s) 79
BsnI GGCC 1 cut(s) 221
Bsp1286I GDGCHC 1 cut(s) 217
Bsp143I GATC 2 cut(s) 4, 186
BspACI CCGC 1 cut(s) 161
BspANI GGCC 1 cut(s) 221
BspCNI CTCAG 1 cut(s) 49
BspHI TCATGA 2 cut(s) 7, 226
BspPI GGATC 2 cut(s) 12, 181
BsrDI GCAATG 1 cut(s) 156
BsrI ACTGG 1 cut(s) 142
BssECI CCNNGG 3 cut(s) 174, 198, 216
BssMI GATC 2 cut(s) 4, 186
BssNI GRCGYC 1 cut(s) 84
Bst2UI CCWGG 2 cut(s) 74, 200
BstACI GRCGYC 1 cut(s) 84
BstDEI CTNAG 1 cut(s) 57
BstKTI GATC 2 cut(s) 7, 189
BstMBI GATC 2 cut(s) 4, 186
BstMWI GCNNNNNNNGC 1 cut(s) 212
BstNI CCWGG 2 cut(s) 74, 200
BstSCI CCNGG 4 cut(s) 72, 173, 198, 216
BsuRI GGCC 1 cut(s) 221
CciI TCATGA 2 cut(s) 7, 226
CseI GACGC 1 cut(s) 110
CviAII CATG 3 cut(s) 8, 51, 227
CviJI RGCY 3 cut(s) 179, 215, 221
CviKI_1 RGCY 3 cut(s) 179, 215, 221
DdeI CTNAG 1 cut(s) 57
DpnI GATC 2 cut(s) 6, 188
DpnII GATC 2 cut(s) 4, 186
DraI TTTAAA 1 cut(s) 129
EaeI YGGCCR 1 cut(s) 219
Eco24I GRGCYC 1 cut(s) 217
EcoRII CCWGG 2 cut(s) 72, 198
EcoT38I GRGCYC 1 cut(s) 217
FaeI CATG 3 cut(s) 11, 54, 230
FaiI YATR 5 cut(s) 9, 20, 52, 70, 228
FatI CATG 3 cut(s) 7, 50, 226
FauI CCCGC 1 cut(s) 154
FriOI GRGCYC 1 cut(s) 217
HaeIII GGCC 1 cut(s) 221
HapII CCGG 2 cut(s) 174, 218
HgaI GACGC 1 cut(s) 110
Hin1I GRCGYC 1 cut(s) 84
Hin1II CATG 3 cut(s) 11, 54, 230
HinfI GANTC 1 cut(s) 44
HpaII CCGG 2 cut(s) 174, 218
HphI GGTGA 2 cut(s) 176, 187
Hpy166II GTNNAC 1 cut(s) 167
Hpy188III TCNNGA 2 cut(s) 8, 227
Hpy8I GTNNAC 1 cut(s) 167
HpyAV CCTTC 2 cut(s) 17, 158
HpyCH4IV ACGT 1 cut(s) 84
HpyCH4V TGCA 1 cut(s) 117
HpyF10VI GCNNNNNNNGC 1 cut(s) 212
HpyF3I CTNAG 1 cut(s) 57
HpySE526I ACGT 1 cut(s) 84
Hsp92I GRCGYC 1 cut(s) 84
Hsp92II CATG 3 cut(s) 11, 54, 230
Kzo9I GATC 2 cut(s) 4, 186
LmnI GCTCC 2 cut(s) 109, 211
LpnPI CCDG 6 cut(s) 59, 86, 123, 185, 187, 212
MaeII ACGT 1 cut(s) 84
MalI GATC 2 cut(s) 6, 188
MboI GATC 2 cut(s) 4, 186
MboII GAAGA 1 cut(s) 53
MhlI GDGCHC 1 cut(s) 217
MluCI AATT 1 cut(s) 11
MnlI CCTC 3 cut(s) 70, 73, 193
MseI TTAA 1 cut(s) 128
MspI CCGG 2 cut(s) 174, 218
MspR9I CCNGG 4 cut(s) 74, 175, 200, 218
MvaI CCWGG 2 cut(s) 74, 200
MwoI GCNNNNNNNGC 1 cut(s) 212
NciI CCSGG 2 cut(s) 175, 218
NdeII GATC 2 cut(s) 4, 186
NlaIII CATG 3 cut(s) 11, 54, 230
PagI TCATGA 2 cut(s) 7, 226
PfeI GAWTC 1 cut(s) 44
Psp6I CCWGG 2 cut(s) 72, 198
PspGI CCWGG 2 cut(s) 72, 198
SaqAI TTAA 1 cut(s) 128
Sau3AI GATC 2 cut(s) 4, 186
ScrFI CCNGG 4 cut(s) 74, 175, 200, 218
SduI GDGCHC 1 cut(s) 217
SetI ASST 3 cut(s) 28, 87, 150
Sse9I AATT 1 cut(s) 11
SsiI CCGC 1 cut(s) 161
StyD4I CCNGG 4 cut(s) 72, 173, 198, 216
TaiI ACGT 1 cut(s) 87
TaqI TCGA 1 cut(s) 185
TasI AATT 1 cut(s) 11
TfiI GAWTC 1 cut(s) 44
Tru1I TTAA 1 cut(s) 128
Tru9I TTAA 1 cut(s) 128
TspDTI ATGAA 2 cut(s) 24, 145
TspGWI ACGGA 1 cut(s) 96
ZraI GACGTC 1 cut(s) 85
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.