Rorug04G0132900

phospholipase

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Reverse (-)
21360618 .. 21360998
381 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0132900.1

Sequence Viewer

Length: 381 bp
ATGGGTAAAAAGTTGTTTAAGATTTTCATCATTTCAGATGTTATATCATTAGTGTCCTCCACAACCTCAGTAATTATATTTTTGGGACTCCTCACATCACGTTATGCAGAAGATGACTTCCTCACATCTTTGCCCACAAAAATGATGATCGGTCTTTCCACTCTTTTCCTCTCGATTTCTACTATGATGATCACATTTTGTTCTGCCCTTACCATTACGATCGGTGATAATGGAAATTCTAAGACTTTCATCCGAAACCTATTGCTGGCTTTTCTTCCGATCGCCTCATTCATATGGATGCAATTTTCCCTCATCATTGAGATATTCATTGCTACTTATGGACCGGGAATATTTAACAAGAAGATCGAACGTTGGTATTAG

Protein Analysis

126

Amino Acids

14.18

Weight (kDa)

9.21

Isoelectric Point (pI)

31.82

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PGG PF13962 3 - 72 4.8e-11 Domain of unknown function
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 370
AcsI RAATTY 1 cut(s) 235
AfiI CCNNNNNNNGG 1 cut(s) 265
ApoI RAATTY 1 cut(s) 235
AspS9I GGNCC 1 cut(s) 341
AsuC2I CCSGG 1 cut(s) 345
AsuHPI GGTGA 1 cut(s) 236
AvaII GGWCC 1 cut(s) 341
BclI TGATCA 1 cut(s) 189
BcnI CCSGG 1 cut(s) 345
Bme1390I CCNGG 1 cut(s) 345
Bme18I GGWCC 1 cut(s) 341
BmgT120I GGNCC 1 cut(s) 341
BmrFI CCNGG 1 cut(s) 345
BmsI GCATC 1 cut(s) 288
BpuMI CCSGG 1 cut(s) 345
BsaBI GATNNNNATC 1 cut(s) 26
Bsc4I CCNNNNNNNGG 1 cut(s) 265
Bse3DI GCAATG 1 cut(s) 327
Bse8I GATNNNNATC 1 cut(s) 26
BseGI GGATG 2 cut(s) 249, 303
BseJI GATNNNNATC 1 cut(s) 26
BseLI CCNNNNNNNGG 1 cut(s) 265
BseMI GCAATG 1 cut(s) 327
BseMII CTCAG 1 cut(s) 81
BseRI GAGGAG 1 cut(s) 80
Bsh1285I CGRYCG 2 cut(s) 222, 282
BsiEI CGRYCG 2 cut(s) 222, 282
BsiSI CCGG 1 cut(s) 344
BslFI GGGAC 1 cut(s) 99
BslI CCNNNNNNNGG 1 cut(s) 265
BsmFI GGGAC 1 cut(s) 99
Bsp143I GATC 5 cut(s) 147, 189, 219, 279, 363
BspCNI CTCAG 1 cut(s) 80
BsrDI GCAATG 1 cut(s) 327
BssMI GATC 5 cut(s) 147, 189, 219, 279, 363
BstC8I GCNNGC 1 cut(s) 267
BstDEI CTNAG 2 cut(s) 67, 240
BstF5I GGATG 2 cut(s) 249, 303
BstKTI GATC 5 cut(s) 150, 192, 222, 282, 366
BstMBI GATC 5 cut(s) 147, 189, 219, 279, 363
BstMCI CGRYCG 2 cut(s) 222, 282
BstSCI CCNGG 1 cut(s) 343
BtsCI GGATG 2 cut(s) 249, 303
Cac8I GCNNGC 1 cut(s) 267
Cfr13I GGNCC 1 cut(s) 341
CviJI RGCY 1 cut(s) 269
CviKI_1 RGCY 1 cut(s) 269
DdeI CTNAG 2 cut(s) 67, 240
DpnI GATC 5 cut(s) 149, 191, 221, 281, 365
DpnII GATC 5 cut(s) 147, 189, 219, 279, 363
Eco47I GGWCC 1 cut(s) 341
FaiI YATR 7 cut(s) 44, 77, 105, 185, 293, 295, 339
FaqI GGGAC 1 cut(s) 99
FauNDI CATATG 1 cut(s) 293
FbaI TGATCA 1 cut(s) 189
FokI GGATG 2 cut(s) 236, 310
HapII CCGG 1 cut(s) 344
HinfI GANTC 1 cut(s) 87
HpaII CCGG 1 cut(s) 344
HphI GGTGA 1 cut(s) 236
Hpy188I TCNGA 3 cut(s) 37, 254, 279
Hpy188III TCNNGA 1 cut(s) 172
HpyCH4IV ACGT 2 cut(s) 100, 370
HpyCH4V TGCA 2 cut(s) 107, 301
HpyF3I CTNAG 2 cut(s) 67, 240
HpySE526I ACGT 2 cut(s) 100, 370
Ksp22I TGATCA 1 cut(s) 189
Kzo9I GATC 5 cut(s) 147, 189, 219, 279, 363
LpnPI CCDG 2 cut(s) 251, 357
LweI GCATC 1 cut(s) 288
MaeII ACGT 2 cut(s) 100, 370
MalI GATC 5 cut(s) 149, 191, 221, 281, 365
MboI GATC 5 cut(s) 147, 189, 219, 279, 363
MboII GAAGA 3 cut(s) 122, 266, 373
MluCI AATT 3 cut(s) 72, 235, 302
MlyI GAGTC 1 cut(s) 81
MnlI CCTC 7 cut(s) 67, 76, 101, 131, 179, 295, 320
MseI TTAA 2 cut(s) 18, 354
MslI CAYNNNNRTG 3 cut(s) 140, 292, 296
MspI CCGG 1 cut(s) 344
MspR9I CCNGG 1 cut(s) 345
NciI CCSGG 1 cut(s) 345
NdeI CATATG 1 cut(s) 293
NdeII GATC 5 cut(s) 147, 189, 219, 279, 363
Ple19I CGATCG 2 cut(s) 222, 282
PleI GAGTC 1 cut(s) 81
PpsI GAGTC 1 cut(s) 81
Psp1406I AACGTT 1 cut(s) 370
PspPI GGNCC 1 cut(s) 341
PvuI CGATCG 2 cut(s) 222, 282
RseI CAYNNNNRTG 3 cut(s) 140, 292, 296
SaqAI TTAA 2 cut(s) 18, 354
Sau3AI GATC 5 cut(s) 147, 189, 219, 279, 363
Sau96I GGNCC 1 cut(s) 341
SchI GAGTC 1 cut(s) 81
ScrFI CCNGG 1 cut(s) 345
SetI ASST 4 cut(s) 68, 103, 261, 373
SfaNI GCATC 1 cut(s) 288
SgeI CNNG 6 cut(s) 111, 184, 278, 356, 357, 370
SinI GGWCC 1 cut(s) 341
SmiMI CAYNNNNRTG 3 cut(s) 140, 292, 296
Sse9I AATT 3 cut(s) 72, 235, 302
SspI AATATT 1 cut(s) 351
StyD4I CCNGG 1 cut(s) 343
TaiI ACGT 2 cut(s) 103, 373
TaqI TCGA 2 cut(s) 173, 366
TaqII GACCGA 1 cut(s) 140
TasI AATT 3 cut(s) 72, 235, 302
Tru1I TTAA 2 cut(s) 18, 354
Tru9I TTAA 2 cut(s) 18, 354
TspDTI ATGAA 4 cut(s) 16, 238, 280, 316
VpaK11BI GGWCC 1 cut(s) 341
XapI RAATTY 1 cut(s) 235
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.