Rroxscaffold_4G00305790

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Reverse (-)
26429208 .. 26432741
3534 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00305790.1

Sequence Viewer

Length: 156 bp
ATGTCCTTATTTGTAAAAATCTTTTTGAAACTCTCAAAAAACACCGGTCTTGGGACCTTCAAGCTTGGGGAAGATCCTGCACCACCACCACCTAAGGGGGATGGTAAAGTCCATGGAGAAGCACCAAGAAGGAACCGGCGAGAAGATGGTAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

51

Amino Acids

5.59

Weight (kDa)

10.11

Isoelectric Point (pI)

47.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 68
AfiI CCNNNNNNNGG 2 cut(s) 51, 95
AgeI ACCGGT 1 cut(s) 44
AgsI TTSAA 2 cut(s) 28, 61
AluBI AGCT 1 cut(s) 64
AluI AGCT 1 cut(s) 64
AlwI GGATC 1 cut(s) 68
AsiGI ACCGGT 1 cut(s) 44
AspS9I GGNCC 1 cut(s) 54
AvaII GGWCC 1 cut(s) 54
AxyI CCTNAGG 1 cut(s) 93
BccI CCATC 2 cut(s) 95, 140
Bme18I GGWCC 1 cut(s) 54
BmgT120I GGNCC 1 cut(s) 54
BmiI GGNNCC 2 cut(s) 55, 134
BsaJI CCNNGG 1 cut(s) 112
BsaWI WCCGGW 1 cut(s) 44
Bsc4I CCNNNNNNNGG 2 cut(s) 51, 95
Bse118I RCCGGY 2 cut(s) 44, 135
Bse21I CCTNAGG 1 cut(s) 93
BseDI CCNNGG 1 cut(s) 112
BseGI GGATG 1 cut(s) 106
BseLI CCNNNNNNNGG 2 cut(s) 51, 95
BsgI GTGCAG 1 cut(s) 63
BshTI ACCGGT 1 cut(s) 44
BsiSI CCGG 2 cut(s) 45, 136
BslFI GGGAC 1 cut(s) 67
BslI CCNNNNNNNGG 2 cut(s) 51, 95
BsmFI GGGAC 1 cut(s) 67
Bsp143I GATC 1 cut(s) 73
Bsp19I CCATGG 1 cut(s) 112
BspLI GGNNCC 2 cut(s) 55, 134
BspPI GGATC 1 cut(s) 68
BsrFI RCCGGY 2 cut(s) 44, 135
BssAI RCCGGY 2 cut(s) 44, 135
BssECI CCNNGG 1 cut(s) 112
BssMI GATC 1 cut(s) 73
BssT1I CCWWGG 1 cut(s) 112
BstDEI CTNAG 1 cut(s) 93
BstDSI CCRYGG 1 cut(s) 112
BstF5I GGATG 1 cut(s) 106
BstKTI GATC 1 cut(s) 76
BstMBI GATC 1 cut(s) 73
BstX2I RGATCY 1 cut(s) 73
BstYI RGATCY 1 cut(s) 73
Bsu36I CCTNAGG 1 cut(s) 93
BtgI CCRYGG 1 cut(s) 112
BtsCI GGATG 1 cut(s) 106
Cfr10I RCCGGY 2 cut(s) 44, 135
Cfr13I GGNCC 1 cut(s) 54
CspAI ACCGGT 1 cut(s) 44
CviAII CATG 1 cut(s) 113
CviJI RGCY 1 cut(s) 64
CviKI_1 RGCY 1 cut(s) 64
DdeI CTNAG 1 cut(s) 93
DpnI GATC 1 cut(s) 75
DpnII GATC 1 cut(s) 73
Eco130I CCWWGG 1 cut(s) 112
Eco47I GGWCC 1 cut(s) 54
Eco81I CCTNAGG 1 cut(s) 93
EcoO109I RGGNCCY 1 cut(s) 54
EcoT14I CCWWGG 1 cut(s) 112
ErhI CCWWGG 1 cut(s) 112
FaeI CATG 1 cut(s) 116
FaiI YATR 1 cut(s) 114
FaqI GGGAC 1 cut(s) 67
FatI CATG 1 cut(s) 112
FokI GGATG 1 cut(s) 113
HapII CCGG 2 cut(s) 45, 136
Hin1II CATG 1 cut(s) 116
HindIII AAGCTT 1 cut(s) 62
HpaII CCGG 2 cut(s) 45, 136
HpyAV CCTTC 2 cut(s) 67, 123
HpyCH4V TGCA 1 cut(s) 80
HpyF3I CTNAG 1 cut(s) 93
Hsp92II CATG 1 cut(s) 116
Kzo9I GATC 1 cut(s) 73
LpnPI CCDG 3 cut(s) 58, 90, 149
MalI GATC 1 cut(s) 75
MboI GATC 1 cut(s) 73
MboII GAAGA 2 cut(s) 83, 155
MflI RGATCY 1 cut(s) 73
MspI CCGG 2 cut(s) 45, 136
NcoI CCATGG 1 cut(s) 112
NdeII GATC 1 cut(s) 73
NlaIII CATG 1 cut(s) 116
NlaIV GGNNCC 2 cut(s) 55, 134
PinAI ACCGGT 1 cut(s) 44
PpuMI RGGWCCY 1 cut(s) 54
Psp5II RGGWCCY 1 cut(s) 54
PspN4I GGNNCC 2 cut(s) 55, 134
PspPI GGNCC 1 cut(s) 54
PspPPI RGGWCCY 1 cut(s) 54
PsuI RGATCY 1 cut(s) 73
Sau3AI GATC 1 cut(s) 73
Sau96I GGNCC 1 cut(s) 54
SetI ASST 3 cut(s) 59, 66, 94
SgeI CNNG 9 cut(s) 57, 62, 73, 77, 89, 125, 138, 148, 152
SinI GGWCC 1 cut(s) 54
StyI CCWWGG 1 cut(s) 112
VpaK11BI GGWCC 1 cut(s) 54
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.