Rroxscaffold_5G00364800

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Forward (+)
45982419 .. 45993531
11113 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00364800.1

Sequence Viewer

Length: 162 bp
ATGCCGTGTTGTGGTTACAACACCACTTGTCAGTTGCAACGCCACCCTCGCTTCAACGGAACTCTCACATCGACCTTGACATCACTTGGAAACACCATTGCTGGCCCCTTGAACATCATCAATATCAATGCCGACCTGTTCGTTGGCACCGGGTTGCCGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

53

Amino Acids

5.62

Weight (kDa)

7.75

Isoelectric Point (pI)

26.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 146
AfiI CCNNNNNNNGG 1 cut(s) 11
AgsI TTSAA 2 cut(s) 55, 112
AoxI GGCC 1 cut(s) 103
AspS9I GGNCC 1 cut(s) 104
AsuC2I CCSGG 1 cut(s) 151
BanI GGYRCC 1 cut(s) 146
BceAI ACGGC 1 cut(s) 142
BcnI CCSGG 1 cut(s) 151
Bme1390I CCNGG 1 cut(s) 151
BmgT120I GGNCC 1 cut(s) 104
BmiI GGNNCC 2 cut(s) 106, 148
BmrFI CCNGG 1 cut(s) 151
BpuMI CCSGG 1 cut(s) 151
Bsc4I CCNNNNNNNGG 1 cut(s) 11
Bse3DI GCAATG 1 cut(s) 96
BseLI CCNNNNNNNGG 1 cut(s) 11
BseMI GCAATG 1 cut(s) 96
BshFI GGCC 1 cut(s) 105
BshNI GGYRCC 1 cut(s) 146
BsiSI CCGG 1 cut(s) 150
BslI CCNNNNNNNGG 1 cut(s) 11
BsnI GGCC 1 cut(s) 105
BspANI GGCC 1 cut(s) 105
BspLI GGNNCC 2 cut(s) 106, 148
BspT107I GGYRCC 1 cut(s) 146
BsrDI GCAATG 1 cut(s) 96
BstC8I GCNNGC 1 cut(s) 103
BstMWI GCNNNNNNNGC 1 cut(s) 48
BstSCI CCNGG 1 cut(s) 149
BsuRI GGCC 1 cut(s) 105
Cac8I GCNNGC 1 cut(s) 103
Cfr13I GGNCC 1 cut(s) 104
CviJI RGCY 1 cut(s) 105
CviKI_1 RGCY 1 cut(s) 105
HaeIII GGCC 1 cut(s) 105
HapII CCGG 1 cut(s) 150
HpaII CCGG 1 cut(s) 150
HpyCH4V TGCA 1 cut(s) 37
HpyF10VI GCNNNNNNNGC 1 cut(s) 48
LpnPI CCDG 2 cut(s) 87, 149
MaeIII GTNAC 1 cut(s) 14
MnlI CCTC 1 cut(s) 57
MspI CCGG 1 cut(s) 150
MspR9I CCNGG 1 cut(s) 151
MwoI GCNNNNNNNGC 1 cut(s) 48
NciI CCSGG 1 cut(s) 151
NlaIV GGNNCC 2 cut(s) 106, 148
PspN4I GGNNCC 2 cut(s) 106, 148
PspPI GGNCC 1 cut(s) 104
Sau96I GGNCC 1 cut(s) 104
ScrFI CCNGG 1 cut(s) 151
SetI ASST 2 cut(s) 77, 138
SgeI CNNG 8 cut(s) 18, 39, 60, 88, 98, 114, 121, 148
StyD4I CCNGG 1 cut(s) 149
TaqI TCGA 1 cut(s) 71
TspGWI ACGGA 1 cut(s) 72
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.