Rroxscaffold_6G00404000

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Forward (+)
26431943 .. 26436410
4468 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00404000.1

Sequence Viewer

Length: 198 bp
ATGATCCTATGGTCGATCCGTGAGGATCTGACCGTTGGATCATCATATAATTCGATCCGACCGTTGGATCGTTGTTTAATTTATATTTTGAGTTATTGGCTAAGTTTAGATCGCATTGGATTAGGTGATCAATGGATTGACTTGGCGGACGATGGTGAATCGTTGATTGGGCTGTTAAAAAGACGCAGCGGGAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

65

Amino Acids

7.46

Weight (kDa)

4.72

Isoelectric Point (pI)

46.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 146, 189
AclWI GGATC 5 cut(s) 10, 33, 46, 49, 75
AfiI CCNNNNNNNGG 1 cut(s) 64
AjuI GAANNNNNNNTTGG 2 cut(s) 150, 182
AlwI GGATC 5 cut(s) 10, 33, 46, 49, 75
ApeKI GCWGC 1 cut(s) 186
AsuHPI GGTGA 2 cut(s) 137, 167
BccI CCATC 1 cut(s) 146
BclI TGATCA 1 cut(s) 127
BisI GCNGC 1 cut(s) 187
BlsI GCNGC 1 cut(s) 188
Bsc4I CCNNNNNNNGG 1 cut(s) 64
BseLI CCNNNNNNNGG 1 cut(s) 64
Bsh1285I CGRYCG 1 cut(s) 62
BsiEI CGRYCG 1 cut(s) 62
BslI CCNNNNNNNGG 1 cut(s) 64
Bsp143I GATC 8 cut(s) 3, 15, 25, 38, 54, 67, 109, 127
BspACI CCGC 2 cut(s) 146, 189
BspPI GGATC 5 cut(s) 10, 33, 46, 49, 75
BssMI GATC 8 cut(s) 3, 15, 25, 38, 54, 67, 109, 127
Bst4CI ACNGT 2 cut(s) 34, 63
BstDEI CTNAG 1 cut(s) 101
BstKTI GATC 8 cut(s) 6, 18, 28, 41, 57, 70, 112, 130
BstMBI GATC 8 cut(s) 3, 15, 25, 38, 54, 67, 109, 127
BstMCI CGRYCG 1 cut(s) 62
BstX2I RGATCY 1 cut(s) 25
BstYI RGATCY 1 cut(s) 25
CseI GACGC 1 cut(s) 192
CviJI RGCY 2 cut(s) 100, 172
CviKI_1 RGCY 2 cut(s) 100, 172
DdeI CTNAG 1 cut(s) 101
DpnI GATC 8 cut(s) 5, 17, 27, 40, 56, 69, 111, 129
DpnII GATC 8 cut(s) 3, 15, 25, 38, 54, 67, 109, 127
EciI GGCGGA 1 cut(s) 161
FaiI YATR 4 cut(s) 10, 46, 48, 84
FauI CCCGC 1 cut(s) 182
FbaI TGATCA 1 cut(s) 127
Fnu4HI GCNGC 1 cut(s) 187
Fsp4HI GCNGC 1 cut(s) 187
GluI GCNGC 1 cut(s) 187
HgaI GACGC 1 cut(s) 192
HinfI GANTC 1 cut(s) 158
HphI GGTGA 2 cut(s) 137, 167
Hpy188I TCNGA 2 cut(s) 30, 59
HpyCH4III ACNGT 2 cut(s) 34, 63
HpyF3I CTNAG 1 cut(s) 101
Ksp22I TGATCA 1 cut(s) 127
Kzo9I GATC 8 cut(s) 3, 15, 25, 38, 54, 67, 109, 127
MalI GATC 8 cut(s) 5, 17, 27, 40, 56, 69, 111, 129
MboI GATC 8 cut(s) 3, 15, 25, 38, 54, 67, 109, 127
MflI RGATCY 1 cut(s) 25
MluCI AATT 3 cut(s) 49, 78, 193
MmeI TCCRAC 3 cut(s) 16, 45, 82
MnlI CCTC 1 cut(s) 16
MseI TTAA 2 cut(s) 77, 176
MspA1I CMGCKG 1 cut(s) 189
NdeII GATC 8 cut(s) 3, 15, 25, 38, 54, 67, 109, 127
PcsI WCGNNNNNNNCGW 1 cut(s) 59
PfeI GAWTC 1 cut(s) 158
PkrI GCNGC 1 cut(s) 188
PsuI RGATCY 1 cut(s) 25
SaqAI TTAA 2 cut(s) 77, 176
SatI GCNGC 1 cut(s) 187
Sau3AI GATC 8 cut(s) 3, 15, 25, 38, 54, 67, 109, 127
SetI ASST 1 cut(s) 127
SgeI CNNG 2 cut(s) 32, 154
Sse9I AATT 3 cut(s) 49, 78, 193
SsiI CCGC 2 cut(s) 146, 189
TaaI ACNGT 2 cut(s) 34, 63
TaqI TCGA 2 cut(s) 14, 53
TasI AATT 3 cut(s) 49, 78, 193
TfiI GAWTC 1 cut(s) 158
Tru1I TTAA 2 cut(s) 77, 176
Tru9I TTAA 2 cut(s) 77, 176
TseI GCWGC 1 cut(s) 186
TspGWI ACGGA 1 cut(s) 8
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.