Rorug01G0231600

BON1-associated protein 2-like

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
Physical Location & Seq
Forward (+)
33323427 .. 33323699
273 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0231600.1

Sequence Viewer

Length: 195 bp
ATGTTTGAAGACTCTGCTGAAGAAACAGAAGAAAGGCAGCAACAGCAGCATCATAGTGAGTCTGGCATGATGCCTGCAGCAGAAGCAGAAGTAGAAGCAGAGAGGGTTTGCATCGGCTGCAAGTTTGTCATTATGGCCATTATCCGATGGTCACTTGCTCTTTGCTCCCCAAGTGAAGGAAATGACAGGTCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

64

Amino Acids

7.19

Weight (kDa)

4.47

Isoelectric Point (pI)

84.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 135
AcuI CTGAAG 1 cut(s) 39
AfiI CCNNNNNNNGG 1 cut(s) 176
AgsI TTSAA 1 cut(s) 8
AlwNI CAGNNNCTG 1 cut(s) 192
AoxI GGCC 1 cut(s) 135
ApeKI GCWGC 4 cut(s) 37, 46, 77, 117
AspS9I GGNCC 1 cut(s) 189
AvaII GGWCC 1 cut(s) 189
BalI TGGCCA 1 cut(s) 137
BbsI GAAGAC 1 cut(s) 15
BbvI GCAGC 4 cut(s) 49, 58, 89, 104
BccI CCATC 1 cut(s) 141
BfmI CTRYAG 1 cut(s) 75
BisI GCNGC 4 cut(s) 38, 47, 78, 118
BlsI GCNGC 4 cut(s) 39, 48, 79, 119
Bme18I GGWCC 1 cut(s) 189
BmgT120I GGNCC 1 cut(s) 189
BmsI GCATC 3 cut(s) 58, 60, 120
BpiI GAAGAC 1 cut(s) 15
Bsc4I CCNNNNNNNGG 1 cut(s) 176
BseLI CCNNNNNNNGG 1 cut(s) 176
BseXI GCAGC 4 cut(s) 49, 58, 89, 104
BshFI GGCC 1 cut(s) 137
BslI CCNNNNNNNGG 1 cut(s) 176
BsnI GGCC 1 cut(s) 137
BspANI GGCC 1 cut(s) 137
BspMAI CTGCAG 1 cut(s) 79
BstAPI GCANNNNNTGC 1 cut(s) 117
BstC8I GCNNGC 1 cut(s) 75
BstMWI GCNNNNNNNGC 4 cut(s) 43, 46, 83, 117
BstSFI CTRYAG 1 cut(s) 75
BstV1I GCAGC 4 cut(s) 49, 58, 89, 104
BstV2I GAAGAC 1 cut(s) 15
BsuRI GGCC 1 cut(s) 137
Cac8I GCNNGC 1 cut(s) 75
CaiI CAGNNNCTG 1 cut(s) 192
Cfr13I GGNCC 1 cut(s) 189
CviAII CATG 1 cut(s) 67
CviJI RGCY 2 cut(s) 117, 137
CviKI_1 RGCY 2 cut(s) 117, 137
EaeI YGGCCR 1 cut(s) 135
Eco47I GGWCC 1 cut(s) 189
Eco57I CTGAAG 1 cut(s) 39
EcoO109I RGGNCCY 1 cut(s) 189
FaeI CATG 1 cut(s) 70
FaiI YATR 3 cut(s) 54, 68, 134
FatI CATG 1 cut(s) 66
Fnu4HI GCNGC 4 cut(s) 38, 47, 78, 118
Fsp4HI GCNGC 4 cut(s) 38, 47, 78, 118
GluI GCNGC 4 cut(s) 38, 47, 78, 118
HaeIII GGCC 1 cut(s) 137
Hin1II CATG 1 cut(s) 70
HinfI GANTC 2 cut(s) 11, 59
Hpy188I TCNGA 1 cut(s) 146
Hpy188III TCNNGA 1 cut(s) 192
HpyAV CCTTC 1 cut(s) 170
HpyCH4V TGCA 3 cut(s) 77, 111, 120
HpyF10VI GCNNNNNNNGC 4 cut(s) 43, 46, 83, 117
Hsp92II CATG 1 cut(s) 70
LmnI GCTCC 1 cut(s) 170
LpnPI CCDG 3 cut(s) 48, 87, 172
Lsp1109I GCAGC 4 cut(s) 49, 58, 89, 104
LweI GCATC 3 cut(s) 58, 60, 120
MaeIII GTNAC 1 cut(s) 150
MboII GAAGA 3 cut(s) 20, 32, 41
MlsI TGGCCA 1 cut(s) 137
MluNI TGGCCA 1 cut(s) 137
MlyI GAGTC 2 cut(s) 5, 68
MnlI CCTC 1 cut(s) 96
Mox20I TGGCCA 1 cut(s) 137
MscI TGGCCA 1 cut(s) 137
MslI CAYNNNNRTG 1 cut(s) 54
Msp20I TGGCCA 1 cut(s) 137
MwoI GCNNNNNNNGC 4 cut(s) 43, 46, 83, 117
NlaIII CATG 1 cut(s) 70
NmuCI GTSAC 1 cut(s) 150
PkrI GCNGC 4 cut(s) 39, 48, 79, 119
PleI GAGTC 2 cut(s) 5, 67
PpsI GAGTC 2 cut(s) 5, 67
PpuMI RGGWCCY 1 cut(s) 189
Psp5II RGGWCCY 1 cut(s) 189
PspPI GGNCC 1 cut(s) 189
PspPPI RGGWCCY 1 cut(s) 189
PstI CTGCAG 1 cut(s) 79
PstNI CAGNNNCTG 1 cut(s) 192
RseI CAYNNNNRTG 1 cut(s) 54
SatI GCNGC 4 cut(s) 38, 47, 78, 118
Sau96I GGNCC 1 cut(s) 189
SchI GAGTC 2 cut(s) 5, 68
SetI ASST 1 cut(s) 191
SfaNI GCATC 3 cut(s) 58, 60, 120
SfcI CTRYAG 1 cut(s) 75
SgeI CNNG 6 cut(s) 75, 79, 86, 133, 167, 183
SinI GGWCC 1 cut(s) 189
SmiMI CAYNNNNRTG 1 cut(s) 54
TseFI GTSAC 1 cut(s) 150
TseI GCWGC 4 cut(s) 37, 46, 77, 117
Tsp45I GTSAC 1 cut(s) 150
VpaK11BI GGWCC 1 cut(s) 189
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.