Rorug02G0061100

f-box protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
OG0004519
Physical Location & Seq
Reverse (-)
4726197 .. 4727815
1619 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0061100.1

Sequence Viewer

Length: 249 bp
ATGTGTGTTGAGGACCAATTTCACCAGGTACGGAGCGACAACCGAAATGGGAAGGCAAGGCTACTGCAGAGCTACGAGGTCCAAAAGCAGAACAAGTGTGGCCTTTGCCGGAGGACTTCTTCGGCCTACACAAGTGGTTCCCAATCCTCCCCACTTGCCTTCCTGTGCAAGGCGTATCCAGGCAGCCAGGCTGCGTGCGCTACTGCACCGGAATTAAGACTCCGGTTGATCGCGAAAGCGACCGGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
F-box F-box-like FBA_1 FBA_3

Protein Analysis

82

Amino Acids

8.97

Weight (kDa)

9.55

Isoelectric Point (pI)

68.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 233
AfaI GTAC 1 cut(s) 30
AfiI CCNNNNNNNGG 1 cut(s) 169
AjnI CCWGG 3 cut(s) 24, 178, 186
AluBI AGCT 1 cut(s) 72
AluI AGCT 1 cut(s) 72
AoxI GGCC 2 cut(s) 100, 123
ApeKI GCWGC 2 cut(s) 183, 191
AspLEI GCGC 1 cut(s) 200
AspS9I GGNCC 2 cut(s) 13, 79
AsuHPI GGTGA 1 cut(s) 14
AvaII GGWCC 2 cut(s) 13, 79
BbvI GCAGC 2 cut(s) 178, 195
BciT130I CCWGG 3 cut(s) 26, 180, 188
BciVI GTATCC 1 cut(s) 186
BfaI CTAG 1 cut(s) 247
BfmI CTRYAG 1 cut(s) 65
BfuI GTATCC 1 cut(s) 186
BisI GCNGC 2 cut(s) 184, 192
BlsI GCNGC 2 cut(s) 185, 193
Bme1390I CCNGG 3 cut(s) 26, 180, 188
Bme18I GGWCC 2 cut(s) 13, 79
BmgT120I GGNCC 2 cut(s) 13, 79
BmiI GGNNCC 1 cut(s) 139
BmrFI CCNGG 3 cut(s) 26, 180, 188
BsaWI WCCGGW 2 cut(s) 208, 222
Bsc4I CCNNNNNNNGG 1 cut(s) 169
Bse118I RCCGGY 1 cut(s) 242
BseBI CCWGG 3 cut(s) 26, 180, 188
BseLI CCNNNNNNNGG 1 cut(s) 169
BseXI GCAGC 2 cut(s) 178, 195
BsgI GTGCAG 1 cut(s) 189
Bsh1236I CGCG 1 cut(s) 233
Bsh1285I CGRYCG 1 cut(s) 243
BshFI GGCC 2 cut(s) 102, 125
BsiEI CGRYCG 1 cut(s) 243
BsiSI CCGG 4 cut(s) 109, 209, 223, 243
BslI CCNNNNNNNGG 1 cut(s) 169
BsnI GGCC 2 cut(s) 102, 125
Bsp143I GATC 1 cut(s) 228
Bsp68I TCGCGA 1 cut(s) 233
BspANI GGCC 2 cut(s) 102, 125
BspFNI CGCG 1 cut(s) 233
BspLI GGNNCC 1 cut(s) 139
BspMAI CTGCAG 1 cut(s) 69
BsrFI RCCGGY 1 cut(s) 242
BssAI RCCGGY 1 cut(s) 242
BssMI GATC 1 cut(s) 228
Bst2UI CCWGG 3 cut(s) 26, 180, 188
BstC8I GCNNGC 1 cut(s) 196
BstENI CCTNNNNNAGG 1 cut(s) 167
BstFNI CGCG 1 cut(s) 233
BstHHI GCGC 1 cut(s) 200
BstKTI GATC 1 cut(s) 231
BstMBI GATC 1 cut(s) 228
BstMCI CGRYCG 1 cut(s) 243
BstMWI GCNNNNNNNGC 1 cut(s) 197
BstNI CCWGG 3 cut(s) 26, 180, 188
BstSCI CCNGG 3 cut(s) 24, 178, 186
BstSFI CTRYAG 1 cut(s) 65
BstUI CGCG 1 cut(s) 233
BstV1I GCAGC 2 cut(s) 178, 195
BsuI GTATCC 1 cut(s) 186
BsuRI GGCC 2 cut(s) 102, 125
BtuMI TCGCGA 1 cut(s) 233
Cac8I GCNNGC 1 cut(s) 196
CfoI GCGC 1 cut(s) 200
Cfr10I RCCGGY 1 cut(s) 242
Cfr13I GGNCC 2 cut(s) 13, 79
CsiI ACCWGGT 1 cut(s) 24
Csp6I GTAC 1 cut(s) 29
CviJI RGCY 7 cut(s) 61, 72, 102, 125, 186, 191, 246
CviKI_1 RGCY 7 cut(s) 61, 72, 102, 125, 186, 191, 246
CviQI GTAC 1 cut(s) 29
DpnI GATC 1 cut(s) 230
DpnII GATC 1 cut(s) 228
Eco47I GGWCC 2 cut(s) 13, 79
EcoNI CCTNNNNNAGG 1 cut(s) 167
EcoRII CCWGG 3 cut(s) 24, 178, 186
Fnu4HI GCNGC 2 cut(s) 184, 192
Fsp4HI GCNGC 2 cut(s) 184, 192
FspBI CTAG 1 cut(s) 247
GlaI GCGC 1 cut(s) 199
GluI GCNGC 2 cut(s) 184, 192
HaeIII GGCC 2 cut(s) 102, 125
HapII CCGG 4 cut(s) 109, 209, 223, 243
HhaI GCGC 1 cut(s) 200
Hin6I GCGC 1 cut(s) 198
HinP1I GCGC 1 cut(s) 198
HinfI GANTC 1 cut(s) 219
HpaII CCGG 4 cut(s) 109, 209, 223, 243
HphI GGTGA 1 cut(s) 14
Hpy188III TCNNGA 1 cut(s) 232
HpyAV CCTTC 2 cut(s) 46, 169
HpyCH4V TGCA 3 cut(s) 67, 168, 206
HpyF10VI GCNNNNNNNGC 1 cut(s) 197
HspAI GCGC 1 cut(s) 198
Kzo9I GATC 1 cut(s) 228
LmnI GCTCC 1 cut(s) 33
Lsp1109I GCAGC 2 cut(s) 178, 195
MabI ACCWGGT 1 cut(s) 24
MaeI CTAG 1 cut(s) 247
MalI GATC 1 cut(s) 230
MboI GATC 1 cut(s) 228
MboII GAAGA 1 cut(s) 111
MluCI AATT 2 cut(s) 17, 212
MlyI GAGTC 1 cut(s) 213
MnlI CCTC 4 cut(s) 4, 70, 105, 157
MseI TTAA 1 cut(s) 215
MspI CCGG 4 cut(s) 109, 209, 223, 243
MspR9I CCNGG 3 cut(s) 26, 180, 188
MvaI CCWGG 3 cut(s) 26, 180, 188
MvnI CGCG 1 cut(s) 233
MwoI GCNNNNNNNGC 1 cut(s) 197
NdeII GATC 1 cut(s) 228
NlaIV GGNNCC 1 cut(s) 139
NruI TCGCGA 1 cut(s) 233
PkrI GCNGC 2 cut(s) 185, 193
PleI GAGTC 1 cut(s) 213
PpsI GAGTC 1 cut(s) 213
Psp6I CCWGG 3 cut(s) 24, 178, 186
PspGI CCWGG 3 cut(s) 24, 178, 186
PspN4I GGNNCC 1 cut(s) 139
PspPI GGNCC 2 cut(s) 13, 79
PstI CTGCAG 1 cut(s) 69
RruI TCGCGA 1 cut(s) 233
RsaI GTAC 1 cut(s) 30
RsaNI GTAC 1 cut(s) 29
SaqAI TTAA 1 cut(s) 215
SatI GCNGC 2 cut(s) 184, 192
Sau3AI GATC 1 cut(s) 228
Sau96I GGNCC 2 cut(s) 13, 79
SchI GAGTC 1 cut(s) 213
ScrFI CCNGG 3 cut(s) 26, 180, 188
SetI ASST 3 cut(s) 30, 74, 81
SexAI ACCWGGT 1 cut(s) 24
SfcI CTRYAG 1 cut(s) 65
SinI GGWCC 2 cut(s) 13, 79
Sse9I AATT 2 cut(s) 17, 212
SspMI CTAG 1 cut(s) 247
StyD4I CCNGG 3 cut(s) 24, 178, 186
TasI AATT 2 cut(s) 17, 212
Tru1I TTAA 1 cut(s) 215
Tru9I TTAA 1 cut(s) 215
TseI GCWGC 2 cut(s) 183, 191
TspGWI ACGGA 1 cut(s) 46
VpaK11BI GGWCC 2 cut(s) 13, 79
XagI CCTNNNNNAGG 1 cut(s) 167
XspI CTAG 1 cut(s) 247
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.