Rorug02G0316300

Topless-related protein

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Forward (+)
38515710 .. 38518803
3094 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0316300.1

Sequence Viewer

Length: 417 bp
ATGGACCACAATAAAGTTCCTTGGTTTGCTGAGTTCTCCTTTGGTTTGATCAAAGGCTGTGGTTTTGGTGGATTTCGACAGAGTGAGGATTGCAGTAGTTGGAATTCATGGATATATGGGTTTTTTGGTTTAGGGGTTGTGATTGTGTTTCGGATTGGGATTTCGGAATTGATTGAAAAGGCTTTGTTTGTGCTACAGTTTCAACTCTGGGCAATTGATTGCAATACCTTCAAGGTTAGAGCTGCTGAGCTTCGGCAAATACTAGTAGAACTTGGACCGGCGTATATCAAAATCGCTCAGGCTATTTCGTCTCGACCTGTTAATGCAATAAGTGGAACAATTGCATATGAGCTTTATCAATTAGATTTTACAAATAAACATCAACTTCAACTACCTTTAAGGTGTGGCAGCCACTGA

Protein Analysis

138

Amino Acids

15.61

Weight (kDa)

7.69

Isoelectric Point (pI)

41.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 103
AgsI TTSAA 4 cut(s) 176, 203, 232, 389
AhlI ACTAGT 1 cut(s) 262
AluBI AGCT 3 cut(s) 242, 250, 352
AluI AGCT 3 cut(s) 242, 250, 352
Alw26I GTCTC 1 cut(s) 315
AlwNI CAGNNNCTG 1 cut(s) 414
ApeKI GCWGC 2 cut(s) 242, 408
ApoI RAATTY 1 cut(s) 103
AspS9I GGNCC 2 cut(s) 4, 275
AvaII GGWCC 2 cut(s) 4, 275
BbvI GCAGC 1 cut(s) 229
BclI TGATCA 1 cut(s) 48
BcoDI GTCTC 1 cut(s) 315
BcuI ACTAGT 1 cut(s) 262
BfaI CTAG 1 cut(s) 263
BfmI CTRYAG 1 cut(s) 194
BisI GCNGC 2 cut(s) 243, 409
BlpI GCTNAGC 1 cut(s) 246
BlsI GCNGC 2 cut(s) 244, 410
Bme18I GGWCC 2 cut(s) 4, 275
BmgT120I GGNCC 2 cut(s) 4, 275
Bpu10I CCTNAGC 1 cut(s) 297
Bpu1102I GCTNAGC 1 cut(s) 246
BsaJI CCNNGG 1 cut(s) 20
Bse118I RCCGGY 1 cut(s) 277
BseDI CCNNGG 1 cut(s) 20
BseMII CTCAG 3 cut(s) 21, 237, 311
BseXI GCAGC 1 cut(s) 229
BsiSI CCGG 1 cut(s) 278
BsmAI GTCTC 1 cut(s) 315
BsmBI CGTCTC 1 cut(s) 315
Bsp143I GATC 1 cut(s) 48
Bsp1720I GCTNAGC 1 cut(s) 246
BspCNI CTCAG 3 cut(s) 22, 238, 310
BsrFI RCCGGY 1 cut(s) 277
BssAI RCCGGY 1 cut(s) 277
BssECI CCNNGG 1 cut(s) 20
BssMI GATC 1 cut(s) 48
BssT1I CCWWGG 1 cut(s) 20
Bst4CI ACNGT 1 cut(s) 198
BstDEI CTNAG 3 cut(s) 30, 246, 297
BstKTI GATC 1 cut(s) 51
BstMAI GTCTC 1 cut(s) 315
BstMBI GATC 1 cut(s) 48
BstSFI CTRYAG 1 cut(s) 194
BstV1I GCAGC 1 cut(s) 229
BtsIMutI CAGTG 1 cut(s) 412
CaiI CAGNNNCTG 1 cut(s) 414
Cfr10I RCCGGY 1 cut(s) 277
Cfr13I GGNCC 2 cut(s) 4, 275
CspCI CAANNNNNGTGG 2 cut(s) 40, 75
CviAII CATG 1 cut(s) 108
CviJI RGCY 7 cut(s) 57, 182, 242, 250, 302, 352, 411
CviKI_1 RGCY 7 cut(s) 57, 182, 242, 250, 302, 352, 411
DdeI CTNAG 3 cut(s) 30, 246, 297
DpnI GATC 1 cut(s) 50
DpnII GATC 1 cut(s) 48
Eco130I CCWWGG 1 cut(s) 20
Eco47I GGWCC 2 cut(s) 4, 275
EcoRI GAATTC 1 cut(s) 103
EcoT14I CCWWGG 1 cut(s) 20
ErhI CCWWGG 1 cut(s) 20
Esp3I CGTCTC 1 cut(s) 315
FaeI CATG 1 cut(s) 111
FaiI YATR 6 cut(s) 109, 115, 117, 285, 346, 348
FatI CATG 1 cut(s) 107
FauNDI CATATG 1 cut(s) 346
FbaI TGATCA 1 cut(s) 48
Fnu4HI GCNGC 2 cut(s) 243, 409
Fsp4HI GCNGC 2 cut(s) 243, 409
FspBI CTAG 1 cut(s) 263
GluI GCNGC 2 cut(s) 243, 409
HapII CCGG 1 cut(s) 278
Hin1II CATG 1 cut(s) 111
HpaII CCGG 1 cut(s) 278
Hpy188I TCNGA 2 cut(s) 153, 166
Hpy188III TCNNGA 1 cut(s) 312
HpyAV CCTTC 1 cut(s) 238
HpyCH4III ACNGT 1 cut(s) 198
HpyCH4V TGCA 4 cut(s) 93, 222, 326, 344
HpyF3I CTNAG 3 cut(s) 30, 246, 297
Hsp92II CATG 1 cut(s) 111
Ksp22I TGATCA 1 cut(s) 48
Kzo9I GATC 1 cut(s) 48
LpnPI CCDG 4 cut(s) 193, 284, 291, 330
Lsp1109I GCAGC 1 cut(s) 229
MaeI CTAG 1 cut(s) 263
MalI GATC 1 cut(s) 50
MboI GATC 1 cut(s) 48
MfeI CAATTG 2 cut(s) 213, 339
MluCI AATT 5 cut(s) 103, 167, 213, 339, 359
MmeI TCCRAC 1 cut(s) 80
MnlI CCTC 1 cut(s) 79
MseI TTAA 2 cut(s) 321, 398
MspI CCGG 1 cut(s) 278
MunI CAATTG 2 cut(s) 213, 339
NdeI CATATG 1 cut(s) 346
NdeII GATC 1 cut(s) 48
NlaIII CATG 1 cut(s) 111
PkrI GCNGC 2 cut(s) 244, 410
PspPI GGNCC 2 cut(s) 4, 275
PstNI CAGNNNCTG 1 cut(s) 414
SaqAI TTAA 2 cut(s) 321, 398
SatI GCNGC 2 cut(s) 243, 409
Sau3AI GATC 1 cut(s) 48
Sau96I GGNCC 2 cut(s) 4, 275
SetI ASST 8 cut(s) 230, 237, 244, 252, 319, 354, 397, 404
SfcI CTRYAG 1 cut(s) 194
SinI GGWCC 2 cut(s) 4, 275
SpeI ACTAGT 1 cut(s) 262
Sse9I AATT 5 cut(s) 103, 167, 213, 339, 359
SspMI CTAG 1 cut(s) 263
StyI CCWWGG 1 cut(s) 20
TaaI ACNGT 1 cut(s) 198
TaqI TCGA 2 cut(s) 76, 313
TasI AATT 5 cut(s) 103, 167, 213, 339, 359
Tru1I TTAA 2 cut(s) 321, 398
Tru9I TTAA 2 cut(s) 321, 398
TseI GCWGC 2 cut(s) 242, 408
TspDTI ATGAA 1 cut(s) 96
VpaK11BI GGWCC 2 cut(s) 4, 275
XapI RAATTY 1 cut(s) 103
XspI CTAG 1 cut(s) 263
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.