Rorug02G0365700

Binds to actin and affects the structure of the cytoskeleton. At high concentrations, profilin prevents the polymerization of actin, whereas it enhances it at low concentrations

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
OG0000848
Physical Location & Seq
Reverse (-)
46400955 .. 46406030
5076 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0365700.1

Sequence Viewer

Length: 1215 bp
ATGGCTGCTTGTCTGCAACTCAACGCTAAGCCCTTCACCCCTCTTGTCTCTCCGAACCCCCTCTCCAAACACACCTCCAAGCTTGGCAGGGTCCGGTGCTCCGCCGCCCCACCCTCCAAACGCTACACCATCACTCTGCTTCCCGGCGATGGCATTGGCCCCGAAGTCATTTCAGTCGCCAAAAAGGTCCTCAACCTCGCTGCCACCATCGAAGGGATTGAGTTTAAATATCAAGAAATGCCTGTGGGTGGAAATGCCTTGGATTTGACTGGAGTGCCGTTACCAGAAGAGACCCTTTTGGCAGCTAAGCAATCCGATGCAGTTCTGCTGGGAGCAATTGGGGGGTACAAATGGGATAAAAACGAAAAGCATTTAAAACCAGAAACTGGGTTGCTTAAGCTTCGGGAAGGTCTTAAAGTGTTTGCAAATTTGAGGCCAGCAGTTGTTTTACCGCAGTTGGTCGATGCCTCTACTTTGAAGAGAGAGGTCGCCGAAGGGGTTGACCTTATGGTTATAAGAGAGCTCACTGGTGGTATATACTTTGGACAGCCAAGGGGTTTTGGCACTAATGAAAACGGTGAGGAGATTGGTTTCAATACTGAGGTGTATGCTGCCTATGAGATTGATCGTATTGCTCGAGTTGCATTTGAGACTGCTAGGAAGCGGCAGGGAAAGCTCTGTAGTGTTGACAAAGCAAATGTATTGGAGGCATCAATGTTTTGGAGAAAAAGAATCCTGGAAATAGCCTTGGATTATCCTGATGTTGAACTCTCACACATGTATGTTGATAATGCTGCAATGCAGCTTGTTCGTAATCCAAAACAGTTTGATACAATTGTAACAAACAACATATTTGGCGATATATTATCTGATGAGGCCTCAATGATTACTGGAAGTATTGGGATGCTTCCATCTGCTAGTCTTGGAGAATCAGGTCCTGGACTTTTTGAACCTATACATGGTTCTGCTCCTGATATTGCTGGACAGGATAAGGCAAACCCATTAGCAACGGTTCTCAGTGCTGCTATGCTTTTGAAGTACGGTCTTGGAGAAGAAAATGCTGCCAAGAGAATTGAGGCAGCAGTCCTAGATACTTTGAACCGGGGGTTTCGAACAGTTGATATCTATTCGTCTGGAACGAAGTTGGTAGGATGCAAAGAAATGGGTGAAGAGGTATTGAAGTCAGTTGATTCTCTAGTTCCTTCTCCGGTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04013 ko04015 ko04810 ko05131 ko05132 map04013 map04015 map04810 map05131 map05132
Pfam Domains
Protein Families
Profilin

Protein Analysis

404

Amino Acids

43.51

Weight (kDa)

5.64

Isoelectric Point (pI)

34.9

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Iso_dh PF00180 43 - 392 9.8e-140 Isocitrate/isopropylmalate dehydrogenase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 515
AccB7I CCANNNNNTGG 1 cut(s) 386
AciI CCGC 4 cut(s) 102, 105, 452, 664
AcsI RAATTY 1 cut(s) 427
AfaI GTAC 2 cut(s) 347, 1040
AfiI CCNNNNNNNGG 5 cut(s) 149, 213, 248, 386, 959
AflII CTTAAG 1 cut(s) 395
AflIII ACRYGT 1 cut(s) 777
AgsI TTSAA 7 cut(s) 478, 595, 767, 950, 1036, 1099, 1180
AjnI CCWGG 2 cut(s) 735, 937
AloI GAACNNNNNNTCC 2 cut(s) 47, 79
AluBI AGCT 6 cut(s) 82, 305, 400, 523, 676, 805
AluI AGCT 6 cut(s) 82, 305, 400, 523, 676, 805
Alw21I GWGCWC 2 cut(s) 101, 525
Alw26I GTCTC 3 cut(s) 52, 284, 644
AlwNI CAGNNNCTG 2 cut(s) 386, 938
Ama87I CYCGRG 1 cut(s) 636
AoxI GGCC 3 cut(s) 157, 434, 876
ApeKI GCWGC 9 cut(s) 5, 200, 302, 611, 794, 802, 1022, 1061, 1079
ApoI RAATTY 1 cut(s) 427
AspS9I GGNCC 4 cut(s) 91, 158, 187, 935
AsuC2I CCSGG 2 cut(s) 144, 1103
AsuHPI GGTGA 3 cut(s) 28, 590, 1178
AsuII TTCGAA 1 cut(s) 1111
AvaI CYCGRG 1 cut(s) 636
AvaII GGWCC 3 cut(s) 91, 187, 935
BaeI ACNNNNGTAYC 2 cut(s) 822, 855
BanII GRGCYC 1 cut(s) 525
Bbv12I GWGCWC 2 cut(s) 101, 525
BbvI GCAGC 8 cut(s) 187, 314, 598, 781, 814, 1009, 1048, 1091
BccI CCATC 4 cut(s) 137, 143, 215, 919
BceAI ACGGC 1 cut(s) 262
BcgI CGANNNNNNTGC 2 cut(s) 791, 825
BciT130I CCWGG 2 cut(s) 737, 939
BcnI CCSGG 2 cut(s) 144, 1103
BcoDI GTCTC 3 cut(s) 52, 284, 644
BfaI CTAG 4 cut(s) 657, 918, 1088, 1196
BfmI CTRYAG 1 cut(s) 679
BfrI CTTAAG 1 cut(s) 395
BlpI GCTNAGC 2 cut(s) 27, 306
Bme1390I CCNGG 4 cut(s) 144, 737, 939, 1103
Bme18I GGWCC 3 cut(s) 91, 187, 935
BmeT110I CYCGRG 1 cut(s) 636
BmgT120I GGNCC 4 cut(s) 91, 158, 187, 935
BmiI GGNNCC 2 cut(s) 92, 160
BmrFI CCNGG 4 cut(s) 144, 737, 939, 1103
BmrI ACTGGG 1 cut(s) 396
BmsI GCATC 5 cut(s) 307, 454, 719, 894, 1142
BmuI ACTGGG 1 cut(s) 396
BpmI CTGGAG 1 cut(s) 291
Bpu1102I GCTNAGC 2 cut(s) 27, 306
Bpu14I TTCGAA 1 cut(s) 1111
BpuMI CCSGG 2 cut(s) 144, 1103
BsaI GGTCTC 1 cut(s) 284
BsaJI CCNNGG 4 cut(s) 258, 551, 747, 1102
BsaWI WCCGGW 2 cut(s) 93, 1207
BsaXI ACNNNNNCTCC 2 cut(s) 47, 77
Bsc4I CCNNNNNNNGG 5 cut(s) 149, 213, 248, 386, 959
Bse1I ACTGG 4 cut(s) 274, 391, 532, 895
Bse3DI GCAATG 1 cut(s) 804
BseBI CCWGG 2 cut(s) 737, 939
BseDI CCNNGG 4 cut(s) 258, 551, 747, 1102
BseGI GGATG 2 cut(s) 909, 1157
BseLI CCNNNNNNNGG 5 cut(s) 149, 213, 248, 386, 959
BseMI GCAATG 1 cut(s) 804
BseMII CTCAG 2 cut(s) 591, 1030
BseNI ACTGG 4 cut(s) 274, 391, 532, 895
BseRI GAGGAG 1 cut(s) 596
BseXI GCAGC 8 cut(s) 187, 314, 598, 781, 814, 1009, 1048, 1091
BseYI CCCAGC 1 cut(s) 328
BshFI GGCC 3 cut(s) 159, 436, 878
BsiHKAI GWGCWC 2 cut(s) 101, 525
BsiHKCI CYCGRG 1 cut(s) 636
BsiSI CCGG 4 cut(s) 94, 144, 1102, 1208
BslI CCNNNNNNNGG 5 cut(s) 149, 213, 248, 386, 959
BsmAI GTCTC 3 cut(s) 52, 284, 644
BsnI GGCC 3 cut(s) 159, 436, 878
Bso31I GGTCTC 1 cut(s) 284
BsoBI CYCGRG 1 cut(s) 636
Bsp119I TTCGAA 1 cut(s) 1111
Bsp1286I GDGCHC 2 cut(s) 101, 525
Bsp143I GATC 1 cut(s) 625
Bsp1720I GCTNAGC 2 cut(s) 27, 306
BspACI CCGC 4 cut(s) 102, 105, 452, 664
BspANI GGCC 3 cut(s) 159, 436, 878
BspCNI CTCAG 2 cut(s) 592, 1029
BspLI GGNNCC 2 cut(s) 92, 160
BspT104I TTCGAA 1 cut(s) 1111
BspTI CTTAAG 1 cut(s) 395
BspTNI GGTCTC 1 cut(s) 284
BsrDI GCAATG 1 cut(s) 804
BsrI ACTGG 4 cut(s) 274, 391, 532, 895
BssECI CCNNGG 4 cut(s) 258, 551, 747, 1102
BssMI GATC 1 cut(s) 625
BssT1I CCWWGG 3 cut(s) 258, 551, 747
Bst2UI CCWGG 2 cut(s) 737, 939
Bst4CI ACNGT 5 cut(s) 578, 825, 1012, 1043, 1117
Bst6I CTCTTC 3 cut(s) 282, 473, 1164
BstAFI CTTAAG 1 cut(s) 395
BstBI TTCGAA 1 cut(s) 1111
BstC8I GCNNGC 1 cut(s) 438
BstDEI CTNAG 4 cut(s) 27, 306, 600, 1016
BstF5I GGATG 2 cut(s) 909, 1157
BstKTI GATC 1 cut(s) 628
BstMAI GTCTC 3 cut(s) 52, 284, 644
BstMBI GATC 1 cut(s) 625
BstMWI GCNNNNNNNGC 2 cut(s) 641, 673
BstNI CCWGG 2 cut(s) 737, 939
BstNSI RCATGY 1 cut(s) 781
BstSCI CCNGG 4 cut(s) 142, 735, 937, 1101
BstSFI CTRYAG 1 cut(s) 679
BstV1I GCAGC 8 cut(s) 187, 314, 598, 781, 814, 1009, 1048, 1091
BsuRI GGCC 3 cut(s) 159, 436, 878
BtgZI GCGATG 1 cut(s) 162
BtsCI GGATG 2 cut(s) 909, 1157
BtsIMutI CAGTG 2 cut(s) 525, 1024
Cac8I GCNNGC 1 cut(s) 438
CaiI CAGNNNCTG 2 cut(s) 386, 938
Cfr13I GGNCC 4 cut(s) 91, 158, 187, 935
Csp6I GTAC 2 cut(s) 346, 1039
CviAII CATG 2 cut(s) 778, 959
CviQI GTAC 2 cut(s) 346, 1039
DdeI CTNAG 4 cut(s) 27, 306, 600, 1016
DpnI GATC 1 cut(s) 627
DpnII GATC 1 cut(s) 625
DraI TTTAAA 2 cut(s) 226, 375
Eam1104I CTCTTC 3 cut(s) 282, 473, 1164
EarI CTCTTC 3 cut(s) 282, 473, 1164
EciI GGCGGA 1 cut(s) 91
Ecl136II GAGCTC 1 cut(s) 523
Eco130I CCWWGG 3 cut(s) 258, 551, 747
Eco147I AGGCCT 1 cut(s) 878
Eco24I GRGCYC 1 cut(s) 525
Eco31I GGTCTC 1 cut(s) 284
Eco32I GATATC 1 cut(s) 1123
Eco47I GGWCC 3 cut(s) 91, 187, 935
Eco53kI GAGCTC 1 cut(s) 523
Eco88I CYCGRG 1 cut(s) 636
EcoICRI GAGCTC 1 cut(s) 523
EcoO109I RGGNCCY 2 cut(s) 187, 935
EcoRII CCWGG 2 cut(s) 735, 937
EcoRV GATATC 1 cut(s) 1123
EcoT14I CCWWGG 3 cut(s) 258, 551, 747
EcoT38I GRGCYC 1 cut(s) 525
ErhI CCWWGG 3 cut(s) 258, 551, 747
FaeI CATG 2 cut(s) 781, 962
FalI AAGNNNNNCTT 2 cut(s) 279, 311
FatI CATG 2 cut(s) 777, 958
FokI GGATG 2 cut(s) 916, 1164
FriOI GRGCYC 1 cut(s) 525
FspBI CTAG 4 cut(s) 657, 918, 1088, 1196
GsaI CCCAGC 1 cut(s) 332
GsuI CTGGAG 1 cut(s) 291
HaeIII GGCC 3 cut(s) 159, 436, 878
HapII CCGG 4 cut(s) 94, 144, 1102, 1208
Hin1II CATG 2 cut(s) 781, 962
HincII GTYRAC 2 cut(s) 502, 688
HindII GTYRAC 2 cut(s) 502, 688
HindIII AAGCTT 2 cut(s) 80, 398
HinfI GANTC 3 cut(s) 732, 929, 1190
HpaII CCGG 4 cut(s) 94, 144, 1102, 1208
HphI GGTGA 3 cut(s) 28, 590, 1178
Hpy166II GTNNAC 2 cut(s) 502, 688
Hpy188I TCNGA 3 cut(s) 54, 316, 871
Hpy188III TCNNGA 5 cut(s) 233, 404, 758, 971, 1134
Hpy8I GTNNAC 2 cut(s) 502, 688
HpyAV CCTTC 5 cut(s) 43, 206, 401, 488, 1212
HpyCH4III ACNGT 5 cut(s) 578, 825, 1012, 1043, 1117
HpyCH4V TGCA 7 cut(s) 16, 320, 425, 644, 797, 802, 1155
HpyF10VI GCNNNNNNNGC 2 cut(s) 641, 673
HpyF3I CTNAG 4 cut(s) 27, 306, 600, 1016
Hsp92II CATG 2 cut(s) 781, 962
Kzo9I GATC 1 cut(s) 625
LmnI GCTCC 3 cut(s) 104, 332, 973
Lsp1109I GCAGC 8 cut(s) 187, 314, 598, 781, 814, 1009, 1048, 1091
LweI GCATC 5 cut(s) 307, 454, 719, 894, 1142
MaeI CTAG 4 cut(s) 657, 918, 1088, 1196
MaeIII GTNAC 2 cut(s) 279, 838
MalI GATC 1 cut(s) 627
MboI GATC 1 cut(s) 625
MboII GAAGA 4 cut(s) 299, 490, 1064, 1181
MfeI CAATTG 2 cut(s) 336, 834
MhlI GDGCHC 2 cut(s) 101, 525
MluCI AATT 4 cut(s) 336, 427, 834, 1071
MseI TTAA 4 cut(s) 225, 374, 396, 414
MslI CAYNNNNRTG 1 cut(s) 780
MspCI CTTAAG 1 cut(s) 395
MspI CCGG 4 cut(s) 94, 144, 1102, 1208
MspR9I CCNGG 4 cut(s) 144, 737, 939, 1103
MunI CAATTG 2 cut(s) 336, 834
MvaI CCWGG 2 cut(s) 737, 939
MwoI GCNNNNNNNGC 2 cut(s) 641, 673
NciI CCSGG 2 cut(s) 144, 1103
NdeII GATC 1 cut(s) 625
NlaIII CATG 2 cut(s) 781, 962
NlaIV GGNNCC 2 cut(s) 92, 160
NspI RCATGY 1 cut(s) 781
NspV TTCGAA 1 cut(s) 1111
PaeR7I CTCGAG 1 cut(s) 636
PceI AGGCCT 1 cut(s) 878
PciI ACATGT 1 cut(s) 777
PcsI WCGNNNNNNNCGW 2 cut(s) 634, 1136
PfeI GAWTC 3 cut(s) 732, 929, 1190
PflMI CCANNNNNTGG 1 cut(s) 386
PfoI TCCNGGA 2 cut(s) 735, 937
PpuMI RGGWCCY 2 cut(s) 187, 935
PscI ACATGT 1 cut(s) 777
PsiI TTATAA 1 cut(s) 515
Psp124BI GAGCTC 1 cut(s) 525
Psp5II RGGWCCY 2 cut(s) 187, 935
Psp6I CCWGG 2 cut(s) 735, 937
PspFI CCCAGC 1 cut(s) 328
PspGI CCWGG 2 cut(s) 735, 937
PspN4I GGNNCC 2 cut(s) 92, 160
PspPI GGNCC 4 cut(s) 91, 158, 187, 935
PspPPI RGGWCCY 2 cut(s) 187, 935
PspXI VCTCGAGB 1 cut(s) 636
PstNI CAGNNNCTG 2 cut(s) 386, 938
RsaI GTAC 2 cut(s) 347, 1040
RsaNI GTAC 2 cut(s) 346, 1039
RseI CAYNNNNRTG 1 cut(s) 780
SacI GAGCTC 1 cut(s) 525
SaqAI TTAA 4 cut(s) 225, 374, 396, 414
Sau3AI GATC 1 cut(s) 625
Sau96I GGNCC 4 cut(s) 91, 158, 187, 935
ScrFI CCNGG 4 cut(s) 144, 737, 939, 1103
SduI GDGCHC 2 cut(s) 101, 525
SfaNI GCATC 5 cut(s) 307, 454, 719, 894, 1142
SfcI CTRYAG 1 cut(s) 679
Sfr274I CTCGAG 1 cut(s) 636
SfuI TTCGAA 1 cut(s) 1111
SinI GGWCC 3 cut(s) 91, 187, 935
SlaI CTCGAG 1 cut(s) 636
SmiMI CAYNNNNRTG 1 cut(s) 780
SmlI CTYRAG 2 cut(s) 395, 636
SmoI CTYRAG 2 cut(s) 395, 636
Sse9I AATT 4 cut(s) 336, 427, 834, 1071
SseBI AGGCCT 1 cut(s) 878
SsiI CCGC 4 cut(s) 102, 105, 452, 664
SspMI CTAG 4 cut(s) 657, 918, 1088, 1196
SstI GAGCTC 1 cut(s) 525
StuI AGGCCT 1 cut(s) 878
StyD4I CCNGG 4 cut(s) 142, 735, 937, 1101
StyI CCWWGG 3 cut(s) 258, 551, 747
TaaI ACNGT 5 cut(s) 578, 825, 1012, 1043, 1117
TaqI TCGA 4 cut(s) 210, 462, 637, 1111
TasI AATT 4 cut(s) 336, 427, 834, 1071
TauI GCSGC 2 cut(s) 107, 667
TfiI GAWTC 3 cut(s) 732, 929, 1190
Tru1I TTAA 4 cut(s) 225, 374, 396, 414
Tru9I TTAA 4 cut(s) 225, 374, 396, 414
TscAI CASTG 2 cut(s) 532, 1024
TseI GCWGC 9 cut(s) 5, 200, 302, 611, 794, 802, 1022, 1061, 1079
TspDTI ATGAA 1 cut(s) 585
TspRI CASTG 2 cut(s) 532, 1024
Van91I CCANNNNNTGG 1 cut(s) 386
Vha464I CTTAAG 1 cut(s) 395
VpaK11BI GGWCC 3 cut(s) 91, 187, 935
XapI RAATTY 1 cut(s) 427
XceI RCATGY 1 cut(s) 781
XhoI CTCGAG 1 cut(s) 636
XspI CTAG 4 cut(s) 657, 918, 1088, 1196
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.