Rorug02G0552800

Belongs to the UDP-glycosyltransferase family

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Reverse (-)
67999838 .. 67999999
162 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0552800.1

Sequence Viewer

Length: 162 bp
ATGTATTTGCCGAAATCCTTTGTCGACTTCCTTGCAATAAAATTCTTGTTCGATGCAAGTGTGTGTCCAAACGCTGGCAGAGCCTTGTCTCGTTTCTCGTATGTGATCCTAAGTTTATTGGACGGTTTATATGCCTCAAGCATGATGGTAAAACACCAATAA
Functional Annotation

Protein Analysis

53

Amino Acids

5.96

Weight (kDa)

8.98

Isoelectric Point (pI)

32.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 74
AccI GTMKAC 1 cut(s) 24
AclWI GGATC 1 cut(s) 100
AcsI RAATTY 1 cut(s) 41
AfiI CCNNNNNNNGG 1 cut(s) 74
Alw26I GTCTC 1 cut(s) 93
AlwI GGATC 1 cut(s) 100
ApoI RAATTY 1 cut(s) 41
BccI CCATC 1 cut(s) 139
BcgI CGANNNNNNTGC 2 cut(s) 14, 48
BcoDI GTCTC 1 cut(s) 93
BmsI GCATC 1 cut(s) 43
BpuEI CTTGAG 1 cut(s) 121
Bsc4I CCNNNNNNNGG 1 cut(s) 74
BseLI CCNNNNNNNGG 1 cut(s) 74
BslI CCNNNNNNNGG 1 cut(s) 74
BsmAI GTCTC 1 cut(s) 93
Bsp143I GATC 1 cut(s) 105
BspPI GGATC 1 cut(s) 100
BssMI GATC 1 cut(s) 105
Bst4CI ACNGT 1 cut(s) 125
BstC8I GCNNGC 1 cut(s) 76
BstDEI CTNAG 1 cut(s) 110
BstKTI GATC 1 cut(s) 108
BstMAI GTCTC 1 cut(s) 93
BstMBI GATC 1 cut(s) 105
BstMWI GCNNNNNNNGC 1 cut(s) 80
Cac8I GCNNGC 1 cut(s) 76
CviAII CATG 1 cut(s) 142
CviJI RGCY 1 cut(s) 83
CviKI_1 RGCY 1 cut(s) 83
DdeI CTNAG 1 cut(s) 110
DpnI GATC 1 cut(s) 107
DpnII GATC 1 cut(s) 105
FaeI CATG 1 cut(s) 145
FaiI YATR 4 cut(s) 102, 130, 132, 143
FatI CATG 1 cut(s) 141
FblI GTMKAC 1 cut(s) 24
Hin1II CATG 1 cut(s) 145
HincII GTYRAC 1 cut(s) 25
HindII GTYRAC 1 cut(s) 25
Hpy166II GTNNAC 1 cut(s) 25
Hpy8I GTNNAC 1 cut(s) 25
HpyCH4III ACNGT 1 cut(s) 125
HpyCH4V TGCA 2 cut(s) 35, 56
HpyF10VI GCNNNNNNNGC 1 cut(s) 80
HpyF3I CTNAG 1 cut(s) 110
Hsp92II CATG 1 cut(s) 145
Kzo9I GATC 1 cut(s) 105
LpnPI CCDG 1 cut(s) 60
LweI GCATC 1 cut(s) 43
MalI GATC 1 cut(s) 107
MboI GATC 1 cut(s) 105
MluCI AATT 1 cut(s) 41
MnlI CCTC 1 cut(s) 145
MwoI GCNNNNNNNGC 1 cut(s) 80
NdeII GATC 1 cut(s) 105
NlaIII CATG 1 cut(s) 145
PflMI CCANNNNNTGG 1 cut(s) 74
SalI GTCGAC 1 cut(s) 23
Sau3AI GATC 1 cut(s) 105
SfaNI GCATC 1 cut(s) 43
SgeI CNNG 9 cut(s) 44, 58, 69, 87, 97, 102, 109, 150, 154
SmlI CTYRAG 1 cut(s) 136
SmoI CTYRAG 1 cut(s) 136
Sse9I AATT 1 cut(s) 41
TaaI ACNGT 1 cut(s) 125
TaqI TCGA 2 cut(s) 24, 51
TasI AATT 1 cut(s) 41
Van91I CCANNNNNTGG 1 cut(s) 74
XapI RAATTY 1 cut(s) 41
XmiI GTMKAC 1 cut(s) 24
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.