Rorug06G0174100
ERF Family

Eukaryotic peptide chain release factor subunit

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000006
Physical Location & Seq
Reverse (-)
27118773 .. 27120896
2124 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug06G0174100.1

Sequence Viewer

Length: 270 bp
ATGGATATGTTAGCCTCAATTATAATACAAGAGATCTTTGAGACTACTGGATGCATTGCAAGTGCTGGCATAGCTAGAAATATGCTCATGGCTCGCCTTACAACAAGAACTGCTAAACCAGACGGTCAATGCAACATTCCTCCCAAAAGGTGCAATATGCAAGAAGGGATGGAGGGAAATCCTGTTGCTAAAACCATGAAGACTGTTTCAAGAGGCATGGCTGTTCTTACAGTTCCGTTTACCATGGAATTTCCAAAGAGTGTAGGCTGA

Protein Analysis

89

Amino Acids

9.64

Weight (kDa)

9.02

Isoelectric Point (pI)

33.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 23
AcsI RAATTY 1 cut(s) 248
AgsI TTSAA 1 cut(s) 210
AluBI AGCT 1 cut(s) 74
AluI AGCT 1 cut(s) 74
Alw26I GTCTC 1 cut(s) 35
ApoI RAATTY 1 cut(s) 248
BbsI GAAGAC 1 cut(s) 206
BccI CCATC 1 cut(s) 163
BcoDI GTCTC 1 cut(s) 35
BfaI CTAG 1 cut(s) 75
BglII AGATCT 1 cut(s) 33
BmsI GCATC 1 cut(s) 41
BpiI GAAGAC 1 cut(s) 206
BsaJI CCNNGG 1 cut(s) 243
Bse1I ACTGG 1 cut(s) 52
Bse3DI GCAATG 1 cut(s) 54
BseDI CCNNGG 1 cut(s) 243
BseGI GGATG 2 cut(s) 56, 174
BseMI GCAATG 1 cut(s) 54
BseNI ACTGG 1 cut(s) 52
BsmAI GTCTC 1 cut(s) 35
Bsp143I GATC 1 cut(s) 33
Bsp19I CCATGG 1 cut(s) 243
BsrDI GCAATG 1 cut(s) 54
BsrI ACTGG 1 cut(s) 52
BssECI CCNNGG 1 cut(s) 243
BssMI GATC 1 cut(s) 33
BssT1I CCWWGG 1 cut(s) 243
Bst4CI ACNGT 3 cut(s) 125, 205, 232
BstC8I GCNNGC 2 cut(s) 67, 94
BstDSI CCRYGG 1 cut(s) 243
BstF5I GGATG 2 cut(s) 56, 174
BstKTI GATC 1 cut(s) 36
BstMAI GTCTC 1 cut(s) 35
BstMBI GATC 1 cut(s) 33
BstMWI GCNNNNNNNGC 1 cut(s) 71
BstV2I GAAGAC 1 cut(s) 206
BstX2I RGATCY 1 cut(s) 33
BstYI RGATCY 1 cut(s) 33
BtgI CCRYGG 1 cut(s) 243
BtsCI GGATG 2 cut(s) 56, 174
Cac8I GCNNGC 2 cut(s) 67, 94
CviAII CATG 4 cut(s) 88, 196, 217, 244
CviJI RGCY 5 cut(s) 14, 74, 92, 221, 267
CviKI_1 RGCY 5 cut(s) 14, 74, 92, 221, 267
DpnI GATC 1 cut(s) 35
DpnII GATC 1 cut(s) 33
Eco130I CCWWGG 1 cut(s) 243
EcoT14I CCWWGG 1 cut(s) 243
EcoT22I ATGCAT 1 cut(s) 56
ErhI CCWWGG 1 cut(s) 243
FaeI CATG 4 cut(s) 91, 199, 220, 247
FaiI YATR 9 cut(s) 8, 23, 71, 83, 89, 158, 197, 218, 245
FatI CATG 4 cut(s) 87, 195, 216, 243
FokI GGATG 2 cut(s) 63, 181
FspBI CTAG 1 cut(s) 75
Hin1II CATG 4 cut(s) 91, 199, 220, 247
Hpy166II GTNNAC 1 cut(s) 240
Hpy188III TCNNGA 1 cut(s) 210
Hpy8I GTNNAC 1 cut(s) 240
HpyAV CCTTC 1 cut(s) 158
HpyCH4III ACNGT 3 cut(s) 125, 205, 232
HpyCH4V TGCA 5 cut(s) 54, 59, 132, 153, 160
HpyF10VI GCNNNNNNNGC 1 cut(s) 71
Hsp92II CATG 4 cut(s) 91, 199, 220, 247
Kzo9I GATC 1 cut(s) 33
LpnPI CCDG 4 cut(s) 33, 51, 132, 195
LweI GCATC 1 cut(s) 41
MaeI CTAG 1 cut(s) 75
MalI GATC 1 cut(s) 35
MboI GATC 1 cut(s) 33
MboII GAAGA 1 cut(s) 211
MflI RGATCY 1 cut(s) 33
MluCI AATT 2 cut(s) 18, 248
MnlI CCTC 4 cut(s) 25, 150, 166, 206
Mph1103I ATGCAT 1 cut(s) 56
MwoI GCNNNNNNNGC 1 cut(s) 71
NcoI CCATGG 1 cut(s) 243
NdeII GATC 1 cut(s) 33
NlaIII CATG 4 cut(s) 91, 199, 220, 247
NsiI ATGCAT 1 cut(s) 56
PsiI TTATAA 1 cut(s) 23
PsuI RGATCY 1 cut(s) 33
Sau3AI GATC 1 cut(s) 33
SetI ASST 2 cut(s) 76, 152
SfaNI GCATC 1 cut(s) 41
Sse9I AATT 2 cut(s) 18, 248
SspMI CTAG 1 cut(s) 75
StyI CCWWGG 1 cut(s) 243
TaaI ACNGT 3 cut(s) 125, 205, 232
TasI AATT 2 cut(s) 18, 248
TspDTI ATGAA 1 cut(s) 212
TspGWI ACGGA 1 cut(s) 225
XapI RAATTY 1 cut(s) 248
XspI CTAG 1 cut(s) 75
Zsp2I ATGCAT 1 cut(s) 56
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.