Rh1AG428000

Cytochrome p450

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
OG0000853
Physical Location & Seq
Reverse (-)
65580319 .. 65580699
381 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG428000.1

Sequence Viewer

Length: 381 bp
ATGGGAACCTGGCTCATACTCATTGTTACCACCCTCATTATCTCTTTTCTTCTCAAAACAATTCTTAGTCTCATCTCCACCAAAACCAACACCAAGAAACTCCCTCCTGGACCCCTCGCCGTTCCCATAATTGGCAGCTTTTTATGGCTACGTAAATCATTTTCTGACGTAGAGGTTGGACTCCGAAAACTCCTGTGCCAATATGGTCCTATCCTCAACCTCTACATTGGCTCAAGCCCTGCCATATTCGTTGCCAACTACTCCCTGTCACACCAAGCCTTGATCCAAAATGGTGCTGAATTTGCAGACAGGCCACCAGCCTTTGCCACTTACAAAATCATAACTAGTAACCAACACAACATTGGCTCTGCAGTGTATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00140 ko00380 ko00830 ko00980 ko01100 ko04913 ko04917 ko04927 ko04934 ko05204 map00140 map00380 map00830 map00980 map01100 map04913 map04917 map04927 map04934 map05204
Pfam Domains
Protein Families
p450

Protein Analysis

126

Amino Acids

13.81

Weight (kDa)

9.72

Isoelectric Point (pI)

27.83

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
p450 PF00067 35 - 114 1.3e-11 Cytochrome P450
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 277
AcsI RAATTY 1 cut(s) 299
AfiI CCNNNNNNNGG 1 cut(s) 131
AhlI ACTAGT 1 cut(s) 344
AjnI CCWGG 2 cut(s) 8, 106
AluBI AGCT 1 cut(s) 138
AluI AGCT 1 cut(s) 138
Alw26I GTCTC 1 cut(s) 74
AlwI GGATC 1 cut(s) 277
AoxI GGCC 1 cut(s) 311
ApeKI GCWGC 1 cut(s) 135
ApoI RAATTY 1 cut(s) 299
AspS9I GGNCC 2 cut(s) 110, 206
AvaII GGWCC 2 cut(s) 110, 206
BbvI GCAGC 1 cut(s) 147
BceAI ACGGC 1 cut(s) 104
BciT130I CCWGG 2 cut(s) 10, 108
BcoDI GTCTC 1 cut(s) 74
BcuI ACTAGT 1 cut(s) 344
BfaI CTAG 1 cut(s) 345
BfmI CTRYAG 1 cut(s) 369
BisI GCNGC 1 cut(s) 136
BlsI GCNGC 1 cut(s) 137
Bme1390I CCNGG 2 cut(s) 10, 108
Bme18I GGWCC 2 cut(s) 110, 206
BmgT120I GGNCC 2 cut(s) 110, 206
BmiI GGNNCC 2 cut(s) 7, 112
BmrFI CCNGG 2 cut(s) 10, 108
BpuEI CTTGAG 1 cut(s) 217
BsaAI YACGTR 1 cut(s) 152
Bsc4I CCNNNNNNNGG 1 cut(s) 131
BseBI CCWGG 2 cut(s) 10, 108
BseLI CCNNNNNNNGG 1 cut(s) 131
BseXI GCAGC 1 cut(s) 147
BshFI GGCC 1 cut(s) 313
BslI CCNNNNNNNGG 1 cut(s) 131
BsmAI GTCTC 1 cut(s) 74
BsnI GGCC 1 cut(s) 313
Bsp143I GATC 1 cut(s) 282
BspANI GGCC 1 cut(s) 313
BspLI GGNNCC 2 cut(s) 7, 112
BspMAI CTGCAG 1 cut(s) 373
BspPI GGATC 1 cut(s) 277
BssMI GATC 1 cut(s) 282
Bst2UI CCWGG 2 cut(s) 10, 108
BstBAI YACGTR 1 cut(s) 152
BstDEI CTNAG 1 cut(s) 65
BstKTI GATC 1 cut(s) 285
BstMAI GTCTC 1 cut(s) 74
BstMBI GATC 1 cut(s) 282
BstMWI GCNNNNNNNGC 1 cut(s) 302
BstNI CCWGG 2 cut(s) 10, 108
BstSCI CCNGG 2 cut(s) 8, 106
BstSFI CTRYAG 1 cut(s) 369
BstSNI TACGTA 1 cut(s) 152
BstV1I GCAGC 1 cut(s) 147
BsuRI GGCC 1 cut(s) 313
BtsI GCAGTG 1 cut(s) 378
BtsIMutI CAGTG 1 cut(s) 378
Cfr13I GGNCC 2 cut(s) 110, 206
CviJI RGCY 9 cut(s) 13, 138, 148, 231, 237, 278, 313, 320, 366
CviKI_1 RGCY 9 cut(s) 13, 138, 148, 231, 237, 278, 313, 320, 366
DdeI CTNAG 1 cut(s) 65
DpnI GATC 1 cut(s) 284
DpnII GATC 1 cut(s) 282
Eco105I TACGTA 1 cut(s) 152
Eco47I GGWCC 2 cut(s) 110, 206
EcoRII CCWGG 2 cut(s) 8, 106
FaiI YATR 6 cut(s) 17, 128, 145, 204, 245, 341
Fnu4HI GCNGC 1 cut(s) 136
Fsp4HI GCNGC 1 cut(s) 136
FspBI CTAG 1 cut(s) 345
GluI GCNGC 1 cut(s) 136
HaeIII GGCC 1 cut(s) 313
HinfI GANTC 1 cut(s) 180
Hpy188I TCNGA 2 cut(s) 166, 185
HpyCH4IV ACGT 2 cut(s) 151, 168
HpyCH4V TGCA 2 cut(s) 305, 371
HpyF10VI GCNNNNNNNGC 1 cut(s) 302
HpyF3I CTNAG 1 cut(s) 65
HpySE526I ACGT 2 cut(s) 151, 168
Kzo9I GATC 1 cut(s) 282
LpnPI CCDG 8 cut(s) 22, 93, 120, 206, 252, 278, 295, 330
Lsp1109I GCAGC 1 cut(s) 147
MaeI CTAG 1 cut(s) 345
MaeII ACGT 2 cut(s) 151, 168
MaeIII GTNAC 3 cut(s) 25, 267, 347
MalI GATC 1 cut(s) 284
MboI GATC 1 cut(s) 282
MboII GAAGA 1 cut(s) 41
MluCI AATT 3 cut(s) 60, 129, 299
MlyI GAGTC 1 cut(s) 174
MmeI TCCRAC 1 cut(s) 157
MnlI CCTC 6 cut(s) 44, 114, 125, 166, 224, 230
MspR9I CCNGG 2 cut(s) 10, 108
MvaI CCWGG 2 cut(s) 10, 108
MwoI GCNNNNNNNGC 1 cut(s) 302
NdeII GATC 1 cut(s) 282
NlaIV GGNNCC 2 cut(s) 7, 112
NmuCI GTSAC 1 cut(s) 267
PfoI TCCNGGA 1 cut(s) 106
PkrI GCNGC 1 cut(s) 137
PleI GAGTC 1 cut(s) 174
PpsI GAGTC 1 cut(s) 174
Ppu21I YACGTR 1 cut(s) 152
Psp6I CCWGG 2 cut(s) 8, 106
PspGI CCWGG 2 cut(s) 8, 106
PspN4I GGNNCC 2 cut(s) 7, 112
PspPI GGNCC 2 cut(s) 110, 206
PstI CTGCAG 1 cut(s) 373
SatI GCNGC 1 cut(s) 136
Sau3AI GATC 1 cut(s) 282
Sau96I GGNCC 2 cut(s) 110, 206
SchI GAGTC 1 cut(s) 174
ScrFI CCNGG 2 cut(s) 10, 108
SetI ASST 6 cut(s) 11, 140, 154, 171, 177, 222
SfcI CTRYAG 1 cut(s) 369
SinI GGWCC 2 cut(s) 110, 206
SmlI CTYRAG 1 cut(s) 232
SmoI CTYRAG 1 cut(s) 232
SnaBI TACGTA 1 cut(s) 152
SpeI ACTAGT 1 cut(s) 344
Sse9I AATT 3 cut(s) 60, 129, 299
SspMI CTAG 1 cut(s) 345
StyD4I CCNGG 2 cut(s) 8, 106
TaiI ACGT 2 cut(s) 154, 171
TasI AATT 3 cut(s) 60, 129, 299
TscAI CASTG 1 cut(s) 378
TseFI GTSAC 1 cut(s) 267
TseI GCWGC 1 cut(s) 135
Tsp45I GTSAC 1 cut(s) 267
TspRI CASTG 1 cut(s) 378
VpaK11BI GGWCC 2 cut(s) 110, 206
XapI RAATTY 1 cut(s) 299
XcmI CCANNNNNNNNNTGG 1 cut(s) 359
XspI CTAG 1 cut(s) 345
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.