Rh3DG181100

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
Physical Location & Seq
Forward (+)
16104351 .. 16104759
409 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG181100.1

Sequence Viewer

Length: 198 bp
ATGTCTTCAATTGGTGATACATGTATACGAGCCTTTCTAGAGACCACCCAAGTAGTAATTCTGGAACATCTAATTAAGCAGACCAACAAGTATTCTATAACAAAGTGTTCTGGCGACAAGCGCGACCGCAAGAAGAAGAGGTCGTCGAAGAACGTCACTGAGGAGCAAATAGCCGAGTACTTGGCTAAAAAGGCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

65

Amino Acids

7.43

Weight (kDa)

9.6

Isoelectric Point (pI)

47.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 25
AccII CGCG 1 cut(s) 123
AciI CCGC 1 cut(s) 127
AfaI GTAC 1 cut(s) 179
AflIII ACRYGT 1 cut(s) 20
AgsI TTSAA 1 cut(s) 9
AjuI GAANNNNNNNTTGG 2 cut(s) 42, 74
Alw26I GTCTC 1 cut(s) 35
AspLEI GCGC 1 cut(s) 123
AsuHPI GGTGA 1 cut(s) 26
BcoDI GTCTC 1 cut(s) 35
BfaI CTAG 1 cut(s) 38
BmcAI AGTACT 1 cut(s) 179
BsaI GGTCTC 1 cut(s) 35
BseMII CTCAG 1 cut(s) 150
BseRI GAGGAG 1 cut(s) 176
Bsh1236I CGCG 1 cut(s) 123
Bsh1285I CGRYCG 1 cut(s) 127
BsiEI CGRYCG 1 cut(s) 127
BsmAI GTCTC 1 cut(s) 35
Bso31I GGTCTC 1 cut(s) 35
BspACI CCGC 1 cut(s) 127
BspCNI CTCAG 1 cut(s) 151
BspFNI CGCG 1 cut(s) 123
BspTNI GGTCTC 1 cut(s) 35
BssNAI GTATAC 1 cut(s) 26
Bst1107I GTATAC 1 cut(s) 26
Bst6I CTCTTC 1 cut(s) 131
BstDEI CTNAG 1 cut(s) 159
BstFNI CGCG 1 cut(s) 123
BstHHI GCGC 1 cut(s) 123
BstMAI GTCTC 1 cut(s) 35
BstMCI CGRYCG 1 cut(s) 127
BstMWI GCNNNNNNNGC 2 cut(s) 120, 191
BstNSI RCATGY 1 cut(s) 24
BstUI CGCG 1 cut(s) 123
BstZ17I GTATAC 1 cut(s) 26
BtsIMutI CAGTG 1 cut(s) 156
CfoI GCGC 1 cut(s) 123
Csp6I GTAC 1 cut(s) 178
CviAII CATG 1 cut(s) 21
CviJI RGCY 3 cut(s) 32, 173, 185
CviKI_1 RGCY 3 cut(s) 32, 173, 185
CviQI GTAC 1 cut(s) 178
DdeI CTNAG 1 cut(s) 159
Eam1104I CTCTTC 1 cut(s) 131
EarI CTCTTC 1 cut(s) 131
Eco31I GGTCTC 1 cut(s) 35
FaeI CATG 1 cut(s) 24
FaiI YATR 4 cut(s) 22, 26, 98, 196
FatI CATG 1 cut(s) 20
FblI GTMKAC 1 cut(s) 25
FspBI CTAG 1 cut(s) 38
GlaI GCGC 1 cut(s) 122
HhaI GCGC 1 cut(s) 123
Hin1II CATG 1 cut(s) 24
Hin6I GCGC 1 cut(s) 121
HinP1I GCGC 1 cut(s) 121
HphI GGTGA 1 cut(s) 26
Hpy166II GTNNAC 1 cut(s) 26
Hpy188III TCNNGA 2 cut(s) 38, 62
Hpy8I GTNNAC 1 cut(s) 26
Hpy99I CGWCG 1 cut(s) 148
HpyCH4IV ACGT 1 cut(s) 153
HpyF10VI GCNNNNNNNGC 2 cut(s) 120, 191
HpyF3I CTNAG 1 cut(s) 159
HpySE526I ACGT 1 cut(s) 153
Hsp92II CATG 1 cut(s) 24
HspAI GCGC 1 cut(s) 121
LmnI GCTCC 1 cut(s) 163
LpnPI CCDG 2 cut(s) 47, 96
MaeI CTAG 1 cut(s) 38
MaeII ACGT 1 cut(s) 153
MaeIII GTNAC 1 cut(s) 154
MboII GAAGA 3 cut(s) 145, 148, 160
MfeI CAATTG 1 cut(s) 9
MluCI AATT 3 cut(s) 9, 57, 72
MnlI CCTC 2 cut(s) 132, 154
MseI TTAA 1 cut(s) 75
MunI CAATTG 1 cut(s) 9
MvnI CGCG 1 cut(s) 123
MwoI GCNNNNNNNGC 2 cut(s) 120, 191
NlaIII CATG 1 cut(s) 24
NmuCI GTSAC 1 cut(s) 154
NspI RCATGY 1 cut(s) 24
PciI ACATGT 1 cut(s) 20
PscI ACATGT 1 cut(s) 20
RsaI GTAC 1 cut(s) 179
RsaNI GTAC 1 cut(s) 178
SaqAI TTAA 1 cut(s) 75
ScaI AGTACT 1 cut(s) 179
SetI ASST 2 cut(s) 143, 156
Sse9I AATT 3 cut(s) 9, 57, 72
SsiI CCGC 1 cut(s) 127
SspMI CTAG 1 cut(s) 38
TaiI ACGT 1 cut(s) 156
TaqI TCGA 1 cut(s) 146
TasI AATT 3 cut(s) 9, 57, 72
TatI WGTACW 1 cut(s) 177
Tru1I TTAA 1 cut(s) 75
Tru9I TTAA 1 cut(s) 75
TscAI CASTG 1 cut(s) 163
TseFI GTSAC 1 cut(s) 154
Tsp45I GTSAC 1 cut(s) 154
TspRI CASTG 1 cut(s) 163
XbaI TCTAGA 1 cut(s) 37
XceI RCATGY 1 cut(s) 24
XmiI GTMKAC 1 cut(s) 25
XspI CTAG 1 cut(s) 38
ZrmI AGTACT 1 cut(s) 179
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.