Rh2BG033900

Cucumber peeling cupredoxin-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
OG0002685
Physical Location & Seq
Forward (+)
2344211 .. 2345184
974 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG033900.1

Sequence Viewer

Length: 576 bp
ATGGATAGCCGTGTGGCTTTGATGAGCTTCGTGATGGTGGCTTTGCTAATGAAGGGTGCAGCTGCTGGAATTCAGAGTGTCAATTGGACTGTCCCCTCCAATAAGTGGAGTGGGACGCACAATGTGGCGAATGCAACCAAGGATGAATATGATAACTGCTTAAAGACTGCCAAGGTACTAACAAGTACCTCGTTGATCACTCTGAATTCAGGTGGAGTGGGACGCACAATGTGGCGAATGCCAACCAAGGATGAATATGATAGGTGGAGTGGGACGCACAATGTGGCGAATGCAACCAAGGATGAATATGATAACTGCTTAAAGACTGCCAAGGTACTAACAAGTACCTCGTTGATCACTCTTATCGATCTTAATACTTCTGGTCCTCACTACTTCATATGCACCATAGACGATCACTGTGAAAGTGGCCAGAAGCTGGCTATCAACGTTACCAACATTATCAGTCCCACGTTAACTACTCCACCGCCGCCACCAAGCTCAGCTTCAGCTCTGGCTGTTGGGACTTTATTTGCAATCGTGAGCTCCATCCTAGTCACATCCTCAGTCCCACGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Cu_bind_like

Protein Analysis

191

Amino Acids

20.45

Weight (kDa)

7.69

Isoelectric Point (pI)

42.92

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cu_bind_like PF02298 90 - 144 9.5e-11 Plastocyanin-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 105, 436
AciI CCGC 2 cut(s) 485, 488
AclI AACGTT 1 cut(s) 447
AcoI YGGCCR 1 cut(s) 427
AcsI RAATTY 2 cut(s) 69, 205
AcuI CTGAAG 1 cut(s) 489
AdeI CACNNNGTG 3 cut(s) 124, 231, 283
AfaI GTAC 4 cut(s) 177, 187, 336, 346
AfiI CCNNNNNNNGG 2 cut(s) 105, 436
AjuI GAANNNNNNNTTGG 2 cut(s) 487, 519
AluBI AGCT 7 cut(s) 27, 62, 436, 498, 503, 509, 543
AluI AGCT 7 cut(s) 27, 62, 436, 498, 503, 509, 543
Alw21I GWGCWC 1 cut(s) 545
AlwNI CAGNNNCTG 2 cut(s) 65, 436
AoxI GGCC 1 cut(s) 427
ApeKI GCWGC 2 cut(s) 59, 62
ApoI RAATTY 2 cut(s) 69, 205
AspS9I GGNCC 1 cut(s) 383
AvaII GGWCC 1 cut(s) 383
BalI TGGCCA 1 cut(s) 429
BanII GRGCYC 1 cut(s) 545
Bbv12I GWGCWC 1 cut(s) 545
BbvI GCAGC 2 cut(s) 49, 71
BccI CCATC 2 cut(s) 28, 554
BclI TGATCA 2 cut(s) 195, 354
BfaI CTAG 1 cut(s) 551
BisI GCNGC 3 cut(s) 60, 63, 488
BlpI GCTNAGC 1 cut(s) 499
BlsI GCNGC 3 cut(s) 61, 64, 489
Bme18I GGWCC 1 cut(s) 383
BmgT120I GGNCC 1 cut(s) 383
Bpu1102I GCTNAGC 1 cut(s) 499
Bsa29I ATCGAT 1 cut(s) 366
BsaJI CCNNGG 5 cut(s) 138, 171, 246, 297, 330
Bsc4I CCNNNNNNNGG 2 cut(s) 105, 436
BseCI ATCGAT 1 cut(s) 366
BseDI CCNNGG 5 cut(s) 138, 171, 246, 297, 330
BseGI GGATG 5 cut(s) 148, 256, 307, 546, 557
BseLI CCNNNNNNNGG 2 cut(s) 105, 436
BseMII CTCAG 2 cut(s) 513, 576
BseXI GCAGC 2 cut(s) 49, 71
BsgI GTGCAG 1 cut(s) 78
BshFI GGCC 1 cut(s) 429
BshVI ATCGAT 1 cut(s) 366
BsiHKAI GWGCWC 1 cut(s) 545
BslFI GGGAC 7 cut(s) 77, 127, 234, 286, 450, 535, 551
BslI CCNNNNNNNGG 2 cut(s) 105, 436
BsmFI GGGAC 7 cut(s) 77, 127, 234, 286, 450, 535, 551
BsmI GAATGC 3 cut(s) 136, 243, 295
BsnI GGCC 1 cut(s) 429
Bsp1286I GDGCHC 1 cut(s) 545
Bsp143I GATC 4 cut(s) 195, 354, 367, 412
Bsp1720I GCTNAGC 1 cut(s) 499
BspACI CCGC 2 cut(s) 485, 488
BspANI GGCC 1 cut(s) 429
BspCNI CTCAG 2 cut(s) 512, 575
BspDI ATCGAT 1 cut(s) 366
BssECI CCNNGG 5 cut(s) 138, 171, 246, 297, 330
BssMI GATC 4 cut(s) 195, 354, 367, 412
BssT1I CCWWGG 5 cut(s) 138, 171, 246, 297, 330
Bst4CI ACNGT 2 cut(s) 91, 419
BstC8I GCNNGC 1 cut(s) 438
BstDEI CTNAG 2 cut(s) 499, 562
BstF5I GGATG 5 cut(s) 148, 256, 307, 546, 557
BstKTI GATC 4 cut(s) 198, 357, 370, 415
BstMBI GATC 4 cut(s) 195, 354, 367, 412
BstV1I GCAGC 2 cut(s) 49, 71
Bsu15I ATCGAT 1 cut(s) 366
BsuRI GGCC 1 cut(s) 429
BsuTUI ATCGAT 1 cut(s) 366
BtsCI GGATG 5 cut(s) 148, 256, 307, 546, 557
BtsIMutI CAGTG 1 cut(s) 415
Cac8I GCNNGC 1 cut(s) 438
CaiI CAGNNNCTG 2 cut(s) 65, 436
Cfr13I GGNCC 1 cut(s) 383
ClaI ATCGAT 1 cut(s) 366
CseI GACGC 3 cut(s) 124, 231, 283
Csp6I GTAC 4 cut(s) 176, 186, 335, 345
CviQI GTAC 4 cut(s) 176, 186, 335, 345
DdeI CTNAG 2 cut(s) 499, 562
DpnI GATC 4 cut(s) 197, 356, 369, 414
DpnII GATC 4 cut(s) 195, 354, 367, 412
DraIII CACNNNGTG 3 cut(s) 124, 231, 283
EaeI YGGCCR 1 cut(s) 427
Ecl136II GAGCTC 1 cut(s) 543
Eco130I CCWWGG 5 cut(s) 138, 171, 246, 297, 330
Eco24I GRGCYC 1 cut(s) 545
Eco47I GGWCC 1 cut(s) 383
Eco53kI GAGCTC 1 cut(s) 543
Eco57I CTGAAG 1 cut(s) 489
EcoICRI GAGCTC 1 cut(s) 543
EcoRI GAATTC 2 cut(s) 69, 205
EcoT14I CCWWGG 5 cut(s) 138, 171, 246, 297, 330
EcoT38I GRGCYC 1 cut(s) 545
ErhI CCWWGG 5 cut(s) 138, 171, 246, 297, 330
FaiI YATR 6 cut(s) 150, 258, 309, 398, 400, 407
FalI AAGNNNNNCTT 2 cut(s) 487, 519
FaqI GGGAC 7 cut(s) 77, 127, 234, 286, 450, 535, 551
FauNDI CATATG 1 cut(s) 398
FbaI TGATCA 2 cut(s) 195, 354
Fnu4HI GCNGC 3 cut(s) 60, 63, 488
FokI GGATG 5 cut(s) 155, 263, 314, 533, 544
FriOI GRGCYC 1 cut(s) 545
Fsp4HI GCNGC 3 cut(s) 60, 63, 488
FspBI CTAG 1 cut(s) 551
GluI GCNGC 3 cut(s) 60, 63, 488
HaeIII GGCC 1 cut(s) 429
HgaI GACGC 3 cut(s) 124, 231, 283
HincII GTYRAC 1 cut(s) 474
HindII GTYRAC 1 cut(s) 474
HpaI GTTAAC 1 cut(s) 474
Hpy166II GTNNAC 1 cut(s) 474
Hpy188I TCNGA 2 cut(s) 75, 204
Hpy188III TCNNGA 2 cut(s) 31, 538
Hpy8I GTNNAC 1 cut(s) 474
HpyAV CCTTC 1 cut(s) 46
HpyCH4III ACNGT 2 cut(s) 91, 419
HpyCH4IV ACGT 3 cut(s) 447, 470, 571
HpyCH4V TGCA 5 cut(s) 59, 134, 293, 402, 533
HpyF3I CTNAG 2 cut(s) 499, 562
HpySE526I ACGT 3 cut(s) 447, 470, 571
Ksp22I TGATCA 2 cut(s) 195, 354
KspAI GTTAAC 1 cut(s) 474
Kzo9I GATC 4 cut(s) 195, 354, 367, 412
LmnI GCTCC 1 cut(s) 548
LpnPI CCDG 6 cut(s) 51, 195, 366, 422, 443, 497
Lsp1109I GCAGC 2 cut(s) 49, 71
MaeI CTAG 1 cut(s) 551
MaeII ACGT 3 cut(s) 447, 470, 571
MaeIII GTNAC 2 cut(s) 448, 553
MalI GATC 4 cut(s) 197, 356, 369, 414
MboI GATC 4 cut(s) 195, 354, 367, 412
MfeI CAATTG 1 cut(s) 82
MhlI GDGCHC 1 cut(s) 545
MlsI TGGCCA 1 cut(s) 429
MluCI AATT 3 cut(s) 69, 82, 205
MluNI TGGCCA 1 cut(s) 429
MnlI CCTC 5 cut(s) 106, 199, 358, 396, 571
Mox20I TGGCCA 1 cut(s) 429
MscI TGGCCA 1 cut(s) 429
MseI TTAA 5 cut(s) 161, 320, 372, 473, 574
Msp20I TGGCCA 1 cut(s) 429
MspA1I CMGCKG 1 cut(s) 62
MunI CAATTG 1 cut(s) 82
Mva1269I GAATGC 3 cut(s) 136, 243, 295
NdeI CATATG 1 cut(s) 398
NdeII GATC 4 cut(s) 195, 354, 367, 412
NmuCI GTSAC 1 cut(s) 553
PctI GAATGC 3 cut(s) 136, 243, 295
PflMI CCANNNNNTGG 2 cut(s) 105, 436
PkrI GCNGC 3 cut(s) 61, 64, 489
Psp124BI GAGCTC 1 cut(s) 545
Psp1406I AACGTT 1 cut(s) 447
PspPI GGNCC 1 cut(s) 383
PstNI CAGNNNCTG 2 cut(s) 65, 436
PvuII CAGCTG 1 cut(s) 62
RsaI GTAC 4 cut(s) 177, 187, 336, 346
RsaNI GTAC 4 cut(s) 176, 186, 335, 345
SacI GAGCTC 1 cut(s) 545
SaqAI TTAA 5 cut(s) 161, 320, 372, 473, 574
SatI GCNGC 3 cut(s) 60, 63, 488
Sau3AI GATC 4 cut(s) 195, 354, 367, 412
Sau96I GGNCC 1 cut(s) 383
SduI GDGCHC 1 cut(s) 545
SinI GGWCC 1 cut(s) 383
Sse9I AATT 3 cut(s) 69, 82, 205
SsiI CCGC 2 cut(s) 485, 488
SspMI CTAG 1 cut(s) 551
SstI GAGCTC 1 cut(s) 545
StyI CCWWGG 5 cut(s) 138, 171, 246, 297, 330
TaaI ACNGT 2 cut(s) 91, 419
TaiI ACGT 3 cut(s) 450, 473, 574
TaqI TCGA 1 cut(s) 366
TasI AATT 3 cut(s) 69, 82, 205
TauI GCSGC 1 cut(s) 490
Tru1I TTAA 5 cut(s) 161, 320, 372, 473, 574
Tru9I TTAA 5 cut(s) 161, 320, 372, 473, 574
TscAI CASTG 1 cut(s) 422
TseFI GTSAC 1 cut(s) 553
TseI GCWGC 2 cut(s) 59, 62
Tsp45I GTSAC 1 cut(s) 553
TspDTI ATGAA 5 cut(s) 65, 159, 267, 318, 385
TspRI CASTG 1 cut(s) 422
Van91I CCANNNNNTGG 2 cut(s) 105, 436
VpaK11BI GGWCC 1 cut(s) 383
XapI RAATTY 2 cut(s) 69, 205
XspI CTAG 1 cut(s) 551
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.