Rh2CG196400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Reverse (-)
18750937 .. 18761041
10105 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG196400.1

Sequence Viewer

Length: 183 bp
ATGAAGCCTAGTACCACTGTGATTCCATGCAATACAAAGATTGACATGTTCATCAAAGGCACTATGAGGCTTGCAGTTGATAAATGGGGTCGTGTTGAAGTCACAGAACCAGCCAACTTTGAAGTTAAGGAGGTCAACAATCTTTCTCTTGTCGAGTATGAATTACTTAGTGTTGCTGAATGA

Protein Analysis

60

Amino Acids

6.79

Weight (kDa)

5.02

Isoelectric Point (pI)

0.04

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
OB_Ssb-like PF21473 1 - 34 1.9e-10 Single-stranded DNA binding protein Ssb-like, OB fold
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 13
AflIII ACRYGT 1 cut(s) 45
AgsI TTSAA 2 cut(s) 98, 122
BfaI CTAG 1 cut(s) 9
Bst4CI ACNGT 1 cut(s) 19
BstC8I GCNNGC 1 cut(s) 72
BstDEI CTNAG 1 cut(s) 167
BstNSI RCATGY 1 cut(s) 49
BtsIMutI CAGTG 1 cut(s) 15
Cac8I GCNNGC 1 cut(s) 72
Csp6I GTAC 1 cut(s) 12
CviAII CATG 2 cut(s) 27, 46
CviJI RGCY 3 cut(s) 7, 70, 113
CviKI_1 RGCY 3 cut(s) 7, 70, 113
CviQI GTAC 1 cut(s) 12
DdeI CTNAG 1 cut(s) 167
FaeI CATG 2 cut(s) 30, 49
FaiI YATR 4 cut(s) 28, 47, 65, 159
FatI CATG 2 cut(s) 26, 45
FspBI CTAG 1 cut(s) 9
Hin1II CATG 2 cut(s) 30, 49
HincII GTYRAC 1 cut(s) 136
HindII GTYRAC 1 cut(s) 136
HinfI GANTC 1 cut(s) 22
Hpy166II GTNNAC 1 cut(s) 136
Hpy8I GTNNAC 1 cut(s) 136
HpyCH4III ACNGT 1 cut(s) 19
HpyCH4V TGCA 2 cut(s) 30, 74
HpyF3I CTNAG 1 cut(s) 167
Hsp92II CATG 2 cut(s) 30, 49
LpnPI CCDG 1 cut(s) 123
MaeI CTAG 1 cut(s) 9
MaeIII GTNAC 1 cut(s) 100
MluCI AATT 1 cut(s) 161
MnlI CCTC 2 cut(s) 60, 124
MseI TTAA 1 cut(s) 126
NlaIII CATG 2 cut(s) 30, 49
NmuCI GTSAC 1 cut(s) 100
NspI RCATGY 1 cut(s) 49
PciI ACATGT 1 cut(s) 45
PfeI GAWTC 1 cut(s) 22
PscI ACATGT 1 cut(s) 45
RsaI GTAC 1 cut(s) 13
RsaNI GTAC 1 cut(s) 12
SaqAI TTAA 1 cut(s) 126
SetI ASST 1 cut(s) 135
SgeI CNNG 8 cut(s) 21, 39, 58, 83, 104, 122, 161, 166
Sse9I AATT 1 cut(s) 161
SspMI CTAG 1 cut(s) 9
TaaI ACNGT 1 cut(s) 19
TaqI TCGA 1 cut(s) 153
TasI AATT 1 cut(s) 161
TfiI GAWTC 1 cut(s) 22
Tru1I TTAA 1 cut(s) 126
Tru9I TTAA 1 cut(s) 126
TscAI CASTG 1 cut(s) 22
TseFI GTSAC 1 cut(s) 100
Tsp45I GTSAC 1 cut(s) 100
TspDTI ATGAA 3 cut(s) 17, 40, 174
TspRI CASTG 1 cut(s) 22
XceI RCATGY 1 cut(s) 49
XspI CTAG 1 cut(s) 9
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.